TMSB10-thymosin beta 10 Gene View larger

TMSB10-thymosin beta 10 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMSB10-thymosin beta 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMSB10-thymosin beta 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016025
Product type: DNA & cDNA
Ncbi symbol: TMSB10
Origin species: Human
Product name: TMSB10-thymosin beta 10 Gene
Size: 2ug
Accessions: BC016025
Gene id: 9168
Gene description: thymosin beta 10
Synonyms: MIG12; TB10; migration-inducing gene 12; migration-inducing protein 12; thymosin beta 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagacaaaccagacatgggggaaatcgccagcttcgataaggccaagctgaagaaaacggagacgcaggaaaagaacaccctgccgaccaaagagaccattgagcaggagaagcggagtgaaatttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 4
- WD repeat domain 6
- WD repeat domain 5
- GNAS complex locus

Buy TMSB10-thymosin beta 10 Gene now

Add to cart