Login to display prices
Login to display prices
TMSB10-thymosin beta 10 Gene View larger

TMSB10-thymosin beta 10 Gene

PTXBC016025

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMSB10-thymosin beta 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMSB10-thymosin beta 10 Gene

Proteogenix catalog: PTXBC016025
Ncbi symbol: TMSB10
Product name: TMSB10-thymosin beta 10 Gene
Size: 2ug
Accessions: BC016025
Gene id: 9168
Gene description: thymosin beta 10
Synonyms: MIG12; TB10; migration-inducing gene 12; migration-inducing protein 12; thymosin beta 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagacaaaccagacatgggggaaatcgccagcttcgataaggccaagctgaagaaaacggagacgcaggaaaagaacaccctgccgaccaaagagaccattgagcaggagaagcggagtgaaatttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: