Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PCLO-piccolo (presynaptic cytomatrix protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PCLO-piccolo (presynaptic cytomatrix protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001304 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PCLO |
| Origin species: | Human |
| Product name: | PCLO-piccolo (presynaptic cytomatrix protein) Gene |
| Size: | 2ug |
| Accessions: | BC001304 |
| Gene id: | 27445 |
| Gene description: | piccolo (presynaptic cytomatrix protein) |
| Synonyms: | ACZ; PCH3; aczonin; piccolo (presynaptic cytomatrix protein); piccolo presynaptic cytomatrix protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaagtattggaatggaatggaattcccttgacttctaaaacatatgaagaagttcagagtatcattagtcagcaaagtggggaagcagaaatatgtggacctcaatatgctatcagattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NOL1/NOP2/Sun domain family, member 5C - synaptosomal-associated protein, 23kDa - sterile alpha motif domain containing 3 - peroxisomal biogenesis factor 11 alpha |