PCLO-piccolo (presynaptic cytomatrix protein) Gene View larger

PCLO-piccolo (presynaptic cytomatrix protein) Gene

PTXBC001304

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCLO-piccolo (presynaptic cytomatrix protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCLO-piccolo (presynaptic cytomatrix protein) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001304
Product type: DNA & cDNA
Ncbi symbol: PCLO
Origin species: Human
Product name: PCLO-piccolo (presynaptic cytomatrix protein) Gene
Size: 2ug
Accessions: BC001304
Gene id: 27445
Gene description: piccolo (presynaptic cytomatrix protein)
Synonyms: ACZ; PCH3; aczonin; piccolo (presynaptic cytomatrix protein); piccolo presynaptic cytomatrix protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaagtattggaatggaatggaattcccttgacttctaaaacatatgaagaagttcagagtatcattagtcagcaaagtggggaagcagaaatatgtggacctcaatatgctatcagattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NOL1/NOP2/Sun domain family, member 5C
- synaptosomal-associated protein, 23kDa
- sterile alpha motif domain containing 3
- peroxisomal biogenesis factor 11 alpha

Buy PCLO-piccolo (presynaptic cytomatrix protein) Gene now

Add to cart