NCRNA00051-non-protein coding RNA 51 Gene View larger

NCRNA00051-non-protein coding RNA 51 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NCRNA00051-non-protein coding RNA 51 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NCRNA00051-non-protein coding RNA 51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008253
Product type: DNA & cDNA
Ncbi symbol: NCRNA00051
Origin species: Human
Product name: NCRNA00051-non-protein coding RNA 51 Gene
Size: 2ug
Accessions: BC008253
Gene id: 619434
Gene description: non-protein coding RNA 51
Synonyms: NCRNA00051; C8orf43; long intergenic non-protein coding RNA 51
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaggcagtggctggggaatcaaccctgattatcaaggataggaggcctgaagaaccacatgaagagagtgcccacaacccagaggatctcctggatacagctgtgttaccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC9913
- hypothetical protein MGC5566
- hypothetical protein MGC5590
- S100 calcium binding protein P

Buy NCRNA00051-non-protein coding RNA 51 Gene now

Add to cart