Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR51B2-olfactory receptor, family 51, subfamily B, member 2 Gene
PTXBC117461
New product
Data sheet of OR51B2-olfactory receptor, family 51, subfamily B, member 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR51B2-olfactory receptor, family 51, subfamily B, member 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117461 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR51B2 |
| Origin species: | Human |
| Product name: | OR51B2-olfactory receptor, family 51, subfamily B, member 2 Gene |
| Size: | 2ug |
| Accessions: | BC117461 |
| Gene id: | 79345 |
| Gene description: | olfactory receptor, family 51, subfamily B, member 2 |
| Synonyms: | HOR5'Beta3; OR51B1P; olfactory receptor 51B2; odorant receptor HOR5'beta3; olfactory receptor 51B1; olfactory receptor, family 51, subfamily B, member 2; olfactory receptor family 51 subfamily B member 2 (gene/pseudogene) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggcccaatattactgcagccccttttttgctgactggttttccagggctggaggcagctcatcactggatctccatccccttctttgctgtttatgtgtgcatccttctgggcaatggcatgctcctctacctcatcaagcatgaccacagtcttcatgagcccatgtactacttcctcaccatgctggcaggcacagacctcatggtgacattgaccacgatgcctactgtaatgggcatcctatgggtgaatcacagggagattagcagtgtgggctgcttcctacaggcttactttattcactccctttctgttgtggaatcaggttccctcctggcaatggcatatgatcgtttcattgccatccgcaatcctttgagatatgcttccattctcaccaatactagagtcatagcgttaggagtgggagtgtttctaaggggttttgtatccatcctgcctgtaattttgcgtcttttttcattttcatattgcaaatctcatgttatcacacgtgctttctgcctccaccaagaaatcatgagactggcttgtgctgacataactttcaatagactttaccctgtaattttgatctctttaacaatcttcctagactctctgatcatcctcttctcctatattctaattcttaatactgtcataggcattgcctctggtgaagagagagccaaagccctcaatacctgtatctcccacattagttgtgttcttatcttctatgttacggtgatgggtttgacattcatttacagatttgggaagaatgtgccagaggttgtccacattatcatgagttacatctacttcctctttccttctttaatgaaccctgtcatctacagcatcaaaaccaagcaaatacaatatggcattatccgccttttatctaaacataggtttagtagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - wingless-type MMTV integration site family, member 9A - Ras association (RalGDS/AF-6) domain family member 1 - dual specificity phosphatase 22 - dynein, light chain, LC8-type 2 |