Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPAPDC1A-phosphatidic acid phosphatase type 2 domain containing 1A Gene
PTXBC132787
New product
Data sheet of PPAPDC1A-phosphatidic acid phosphatase type 2 domain containing 1A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPAPDC1A-phosphatidic acid phosphatase type 2 domain containing 1A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC132787 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPAPDC1A |
| Origin species: | Human |
| Product name: | PPAPDC1A-phosphatidic acid phosphatase type 2 domain containing 1A Gene |
| Size: | 2ug |
| Accessions: | BC132787 |
| Gene id: | 196051 |
| Gene description: | phosphatidic acid phosphatase type 2 domain containing 1A |
| Synonyms: | phosphatidate phosphatase PPAPDC1A; PPAPDC1A; DPPL2; PPAPDC1; phospholipid phosphatase 4; diacylglycerol pyrophosphate like 2; diacylglycerol pyrophosphate phosphatase-like 2; phosphatidic acid phosphatase type 2 domain containing 1A; phosphatidic acid phosphatase type 2 domain-containing protein 1A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggagctggccattgagatcggggtgcgagccctgctcttcggagtcttcgtttttacagagtttttggatccgttccagagagtcatccagccagaagagatctggctctataaaaatcctttggtgcaatcagataacatacctacccgcctcatgtttgcaatttctttcctcacacccctggctgttatttgtgtggtgaaaattatccggcgaacagacaagactgaaattaaggaagccttcttagcggtgtccttggctcttgctttgaatggagtctgcacaaacactattaaattaatagtgggaagacctcgccccgatttcttttaccgctgctttccagatggagtgatgaactcggaaatgcattgcacaggtgaccccgatctggtgtccgagggccgcaaaagcttccccagcatccattcctcctttgccttttcgggccttggcttcacgacgttctacttggcgggcaagctgcactgcttcaccgagagtgggcggggaaagagctggcggctctgtgctgccatcctgcccttgtactgcgccatgatgattgccctgtcccgcatgtgcgactacaagcatcactggcaagattcctttgtgggtggagtcatcggcctcatttttgcatacatttgctacagacagcactatcctcctctggccaacacagcttgccataaaccctacgttagtctgcgagtcccagcctcactgaagaaagaggagaggcccacagctgacagcgcacccagcttgcctctggaggggatcaccgaaggcccggtatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - piccolo (presynaptic cytomatrix protein) - NOL1/NOP2/Sun domain family, member 5C - synaptosomal-associated protein, 23kDa - sterile alpha motif domain containing 3 |