Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of SLIT1-slit homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLIT1-slit homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC139909 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLIT1 |
| Origin species: | Human |
| Product name: | SLIT1-slit homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC139909 |
| Gene id: | 6585 |
| Gene description: | slit homolog 1 (Drosophila) |
| Synonyms: | MEGF4; SLIL1; SLIT-1; SLIT3; slit homolog 1 protein; multiple EGF-like domains protein 4; multiple epidermal growth factor-like domains protein 4; slit homolog 1; slit guidance ligand 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgactcccgggtgggggtcctcggcggggccggtccggccggagctctggctgctgctgtgggcagccgcgtggcgcctgggtgcctcggcgtgccccgccctctgcacctgcaccggaaccacggtggactgccacggcacggggctgcaggccattcccaagaatatacctcggaacaccgagcgcctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DAN domain family, member 5 - fibroblast growth factor 17 - neuropeptide FF receptor 2 - G protein-coupled receptor 6 |