Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of DAND5-DAN domain family, member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAND5-DAN domain family, member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113476 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAND5 |
| Origin species: | Human |
| Product name: | DAND5-DAN domain family, member 5 Gene |
| Size: | 2ug |
| Accessions: | BC113476 |
| Gene id: | 199699 |
| Gene description: | DAN domain family, member 5 |
| Synonyms: | CER2; CERL2; CKTSF1B3; COCO; CRL2; DANTE; GREM3; SP1; DAN domain family member 5; DAN domain family member 5, BMP antagonist; DAN domain family, member 5; cerberus 2; cerberus-like 2; cerberus-like protein 2; cerl-2; cysteine knot superfamily 1, BMP antagonist 3; gremlin-3; DAN domain BMP antagonist family member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctccttggccagctatccactcttctgtgcctgcttagcggggccctgcctacaggctcagggaggcctgaaccccagtctcctcgacctcagtcctgggctgcagccaatcagacctgggctctgggcccaggggccctgcccccactggtgccagcttctgcccttgggagctggaaggccttcttgggcctgcagaaagccaggcagctggggatgggcaggctgcagcgtgggcaagacgaggtggctgctgtgactctgccgctgaaccctcaggaagtgatccaggggatgtgtaaggctgtgcccttcgttcaggtgttctcccggcccggctgctcagccatacgcctccgaaatcatctgtgctttggtcattgctcctctctctacatccctggctcggaccccaccccactagtcctgtgcaacagctgtatgcctgctcgcaagcgttgggcacccgtggtcctgtggtgtctcactggcagctcagcctcccgtcgacgggtgaagatatccaccatgctgatcgaggggtgtcactgcagcccaaaagcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fibroblast growth factor 17 - neuropeptide FF receptor 2 - G protein-coupled receptor 6 - G protein-coupled receptor 6 |