Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRY-PTPN13-like, Y-linked Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRY-PTPN13-like, Y-linked Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113548 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRY |
| Origin species: | Human |
| Product name: | PRY-PTPN13-like, Y-linked Gene |
| Size: | 2ug |
| Accessions: | BC113548 |
| Gene id: | 9081 |
| Gene description: | PTPN13-like, Y-linked |
| Synonyms: | PRY1; PTPN13LY; PTPN13-like protein, Y-linked; testis-specific PTP-BL-related protein on Y; PTPN13-like, Y-linked |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggagccactgggcttggctttctactttcctggagacaagacaatttgaatggcactgactgccagggatgcaatattttatacttctctgagactacggggagcatgtgttctgaactttccttgaacagaggtcttgaggccagaaggaagaaggatcttaaagactcatttctctggagatatgggaaggttggctgtatctcacttccacttcgtgagatgaccgcctggattaacccaccccaaatttcagagattttccaaggctaccaccagagggtgcacggagctgatgcactgagcctgcaaaccaactctctgagaagcaggttatcttcacagtgcctcggacagagcttccttctcaggacactcgagagaggccgtggtttcagggcacttggggacatctgtggccacgttcatgaagaagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - placenta-specific 9 - thymosin beta15b - interferon, alpha 4 - interferon, omega 1 |