Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PLAC9-placenta-specific 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLAC9-placenta-specific 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117332 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLAC9 |
| Origin species: | Human |
| Product name: | PLAC9-placenta-specific 9 Gene |
| Size: | 2ug |
| Accessions: | BC117332 |
| Gene id: | 219348 |
| Gene description: | placenta-specific 9 |
| Synonyms: | placenta-specific protein 9; placenta specific 9 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggcccctgctctgcgcgctgaccggactggccctgctccgcgccgcgggctctttggccgctgccgaacccttcagccctccgcgaggagactcagctcagagcacagcgtgtgacagacacatggctgtgcaacgccgtctagatgtcatggaggagatggtagagaagaccgtggatcacctggggacagaggtgaaaggcctgctgggcctgctggaggagctggcctggaacctgcccccgggacccttcagccccgctcccgaccttctcggagatggcttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thymosin beta15b - interferon, alpha 4 - interferon, omega 1 - interferon, alpha 4 |