Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 910,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 910,00 €
Data sheet of KIAA0087-KIAA0087 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0087-KIAA0087 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128257 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0087 |
| Origin species: | Human |
| Product name: | KIAA0087-KIAA0087 Gene |
| Size: | 2ug |
| Accessions: | BC128257 |
| Gene id: | 9808 |
| Gene description: | KIAA0087 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagcttgggagtcatcccaacccttgctcaggtgcgaaatcccctgccctctgcctggcactgatagggacggatcagtttctctgcctggagaggcagcctcctgtgacctggatacattggagcctgaacacgggaacagaagggtctctgggaatccaatctcagtctgttgggcttacaaagtgaccaaagtcaaatgctggtctgtgagagaaagaggaggcagacacatcgggggaccgagaagtactttgaagcaccccgctcaccatggtatggggaagaatttggccacatccctgccaactgctgcttctcttggactgggaaagggtcagttgcttgtttctatcagattcatggacaccaccaagaaaagaggccagtctgagacattcaatatttgttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complexin 2 - neuroplastin - transgelin - copine III |