TAGLN-transgelin Gene View larger

TAGLN-transgelin Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TAGLN-transgelin Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TAGLN-transgelin Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010946
Product type: DNA & cDNA
Ncbi symbol: TAGLN
Origin species: Human
Product name: TAGLN-transgelin Gene
Size: 2ug
Accessions: BC010946
Gene id: 6876
Gene description: transgelin
Synonyms: SM22; SMCC; TAGLN1; WS3-10; transgelin; 22 kDa actin-binding protein; SM22-alpha; smooth muscle protein 22-alpha; transgelin variant 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaacaagggtccttcctatggcatgagccgcgaagtgcagccatcccgcttagcctgcctcacccacacccgtgtggtaccttcagccctggccaagctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - copine III
- annexin A4
- pannexin 1
- actin, beta

Buy TAGLN-transgelin Gene now

Add to cart