Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RHOV-ras homolog gene family, member V Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHOV-ras homolog gene family, member V Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC112945 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHOV |
| Origin species: | Human |
| Product name: | RHOV-ras homolog gene family, member V Gene |
| Size: | 2ug |
| Accessions: | BC112945 |
| Gene id: | 171177 |
| Gene description: | ras homolog gene family, member V |
| Synonyms: | rho-related GTP-binding protein RhoV; ARHV; CHP; WRCH2; CDC42-like GTPase 2; GTP-binding protein-like 2; Rho GTPase-like protein ARHV; WRCH-2; WRCH1-related GTPase; Wnt-1 regulated Cdc42 homolog 2; Wnt-1 responsive Cdc42 homolog 2; ras homolog gene family, member V; ras homolog family member V |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgccgcgggagctgagcgaggccgagccgcccccgctccgggccccgacccctcccccgcggcggcgtagcgcgcccccagagctgggcatcaagtgcgtgctggtgggcgacggcgccgtgggcaagagcagcctcatcgtcagctacacctgcaatgggtaccccgcgcgctaccggcccactgcgctggacaccttctctgtgcaagtcctggtggatggagctccggtgcgcattgagctctgggacacagcgggacaggaggattttgaccgacttcgttccctttgctacccggataccgatgtcttcctggcgtgcttcagcgtggtgcagcccagctcctttcaaaacatcacagagaaatggctgcccgagatccgcacgcacaacccccaggcgcctgtgctgctggtgggcacccaggccgacctgagggacgatgtcaacgtactaattcagctggaccaggggggccgggagggccccgtgccccaaccccaggctcagggtctggccgagaagatccgagcctgctgctaccttgagtgctcagccttgacgcagaagaacttgaaggaagtatttgactcggctattctcagtgccattgagcacaaagcccggctggagaagaaactgaatgccaaaggtgtgcgcaccctctcccgctgccgctggaagaagttcttctgcttcgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ40235 - hypothetical LOC100134868 - hypothetical LOC100131551 - hypothetical protein FLJ11292 |