PTXBC117434
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117434 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ11292 |
| Origin species: | Human |
| Product name: | FLJ11292-hypothetical protein FLJ11292 Gene |
| Size: | 2ug |
| Accessions: | BC117434 |
| Gene id: | 55338 |
| Gene description: | hypothetical protein FLJ11292 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggactctggcagcaaatttcaaactgtatgccagacctggccctttgcagtgatataaaatttttcttgaggtgtctggaaagatggctgaataggaacagctctgctctgcagctcccagcgagatcaacgcagaaggagataatttctgcatttccaactaaagtacccagctcatctcattgggactggttagacagtgggtgcagcccacagaaggcaagcagaagcagggtggggtgtcgcctcacccgggaagcgcaaggggtcagggaactccctcccctagccaagggaagctgtgagggactgtgccgtgaggaacggggcattccggcacagatactatgctttccccacggtctttgcaacccacagaccaggagattcccttgggtgcctgcaccaccagggccctgggtttcaagcaaaaaactgggcagccatttgggcagacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - retinitis pigmentosa 9 pseudogene - RUN and FYVE domain containing 4 - lysophosphatidic acid receptor 3 - syntaxin 11 |