Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NECAB2-N-terminal EF-hand calcium binding protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NECAB2-N-terminal EF-hand calcium binding protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131615 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NECAB2 |
| Origin species: | Human |
| Product name: | NECAB2-N-terminal EF-hand calcium binding protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC131615 |
| Gene id: | 54550 |
| Gene description: | N-terminal EF-hand calcium binding protein 2 |
| Synonyms: | EFCBP2; stip-2; N-terminal EF-hand calcium-binding protein 2; EF-hand calcium-binding protein 2; neuronal calcium binding 2; neuronal calcium-binding protein 2; synaptotagmin-interacting protein 2; N-terminal EF-hand calcium binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcgagacggccaatcagatccagtcgctgctgagctcagtggagagtgcggtggaggccatcgaggaacagaccagccagctccgacagaaccacatcaaacccagccacagcgcggcacagacctggtgtggaagccccactcccgcctctgcccccaaccacaagctcatggctatggaacaaggcaagacccttccatctgccacggaggatgcaaaggaagagggtctggaagcccagatcagccgcttggcagagctgattgggaggctggagagcaaagcactgtggttcgacctgcagcagcgcctgtcagatgaagatggcaccaacatgcacctgcagctggtccggcaggagatggccgtgtgccccgagcaactgagcgagtttctggactctctgcgccagtatctgcgggggaccactggcgtgaggaactgcttccacatcactgccgtgaggctctcagatggcttcacctttgtcatctatgagttctgggagacagaggaggcgtggaagaggcacctgcagagccccctgtgtaaggcgttccggcacgtcaaggtggacacactgagccagcctgaggccctctccaggatcttggtgccagctgcttggtgcacggtgggacgggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 72, member A - family with sequence similarity 7, member A1 - family with sequence similarity 30, member A - family with sequence similarity 98, member C |