Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IRGM-immunity-related GTPase family, M Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IRGM-immunity-related GTPase family, M Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IRGM |
| Origin species: | Human |
| Product name: | IRGM-immunity-related GTPase family, M Gene |
| Size: | 2ug |
| Accessions: | BC128168 |
| Gene id: | 345611 |
| Gene description: | immunity-related GTPase family, M |
| Synonyms: | Irgm; Ifggd3; Ifi1; Iigp3; Iipg3; LRG-47; immunity-related GTPase family M protein 1; LPS-stimulated RAW 264.7 macrophage protein 47; OTTMUSPWKG00059374; OTTMUSWSBG00059273; immunity related GTPase m1; immunity-related GTPase family, M; interferon-gamma-inducible GTPase Ifggd3 protein; interferon-inducible GTPase 3; interferon-inducible protein 1; immunity-related GTPase family M member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatgttgagaaagcctcagcagatgggaacttgccagaggtgatctctaacatcaaggagactctgaagatagtgtccaggacaccagttaacatcactatggcaggggactctggcaatgggatgtccaccttcatcagtgcccttcgaaacacaggacatgagggtaaggcctcacctcctactgagctggtaaaagctacccaaagatgtgcctcctatttctcttcccacttttcaaatgtggtgttgtgggacctgcctggcacagggtctgccaccacaaccctggagaactacctgatggaaatgcagttcaaccggtatgacttcatcatggttgcatctgcacaattcagcatgaatcatgtgatgcttgccaaaaccgctgaggacatgggaaagaagttctacattgtctggaccaagctagacatggacctcagcacaggtgccctcccagaagtgcagctactgcagatcagagaaaatgtcctggaaaatctccagaaggagcgggtatgtgaatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ras homolog gene family, member V - hypothetical protein FLJ40235 - hypothetical LOC100134868 - hypothetical LOC100131551 |