Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KIAA1704-KIAA1704 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA1704-KIAA1704 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032333 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA1704 |
| Origin species: | Human |
| Product name: | KIAA1704-KIAA1704 Gene |
| Size: | 2ug |
| Accessions: | BC032333 |
| Gene id: | 55425 |
| Gene description: | KIAA1704 |
| Synonyms: | KIAA1704; AD029; LSR7; bA245H20.2; GPALPP motifs-containing protein 1; lipopolysaccharide specific response-7 protein; lipopolysaccharide-specific response protein 7; GPALPP motifs containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaagagacctgatcggaccggccctgccgcccggcttcaaggcccgcggaacagcggaggacgaagagcgggacccgagccctgttgcaggaccagctctgccccctaattataaaagcagtagttcagattcatcagacagcgatgaagacagtagttctttgtacgaagaaggaaatcaagaatctgaagaagatgacagtggtccaactgcaagaaaacagaggaaaaatcaggatgatgacgatgatgatgatgatgggttttttggaccagcccttcctcctggatttaaaaagcaggatgattctcctccaaggcccataataggtcctgcattgccacctggtttcattaaatctacacagaaaattgacaagggcagagatgatccaggacaacaggtatcatcatcccatttcaactctaaggtttggaaagttttcattgaaagaataagatgtattgtaacaaactccaaactttatgcatgcagttactacaaccactggactcaactgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KIAA0355 - KIAA0087 - complexin 2 - neuroplastin |