Cart 10 Product Products 3 956,90 € (empty)
No products
To be determined Shipping
3 956,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 956,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 956,90 €
View larger 
Data sheet of TPPP-tubulin polymerization promoting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TPPP-tubulin polymerization promoting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131506 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TPPP |
| Origin species: | Human |
| Product name: | TPPP-tubulin polymerization promoting protein Gene |
| Size: | 2ug |
| Accessions: | BC131506 |
| Gene id: | 11076 |
| Gene description: | tubulin polymerization promoting protein |
| Synonyms: | TPPP/p25; TPPP1; p24; p25; p25alpha; tubulin polymerization-promoting protein; 25 kDa brain-specific protein; brain specific protein p25 alpha; glycogen synthase kinase 3 (GSK3) inhibitor p24; p25-alpha; tubulin polymerization promoting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgacaaggccaagcctgccaaagctgccaacaggacgccccccaagtccccgggggacccctcgaaggaccgggcagccaagaggctgtcgctggaatcggagggtgctggtgagggggcagccgcatcccctgagctcagtgccctggaggaggccttccggcgctttgccgtgcacggggacgccagggccaccgggagggagatgcacggcaagaactggtcgaagctgtgcaaggactgccaggtgatcgacggcaggaacgtgaccgtcactgacgtggacatcgtcttcagcaagatcaaagggaagtcttgccggaccatcacctttgagcagttccaggaggcgctggaggagctcgccaagaagcgattcaaagacaagagcagcgaggaggccgttcgcgaggtgcacaggctcatcgagggcaaggcgcccatcatctcaggggtgacgaaagccatctcgtcgcccacagtgtcgaggctcacggacaccaccaagttcacgggctcccacaaggagcgcttcgacccctctggcaagggcaagggcaaggctggccgcgtggatctggtggacgagtcaggctatgtgtccggctacaagcacgcaggcacctacgaccagaaggtgcaagggggcaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - similar to ankyrin repeat domain 20A - glutathione S-transferase mu 2 (muscle) - GTP cyclohydrolase I feedback regulator - complement component 8, gamma polypeptide |