> >>MGC26718-similar to ankyrin repeat domain 20A Gene
MGC26718-similar to ankyrin repeat domain 20A Gene View larger

MGC26718-similar to ankyrin repeat domain 20A Gene

PTXBC127726

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of MGC26718-similar to ankyrin repeat domain 20A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC26718-similar to ankyrin repeat domain 20A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC127726
Product type: DNA & cDNA
Ncbi symbol: MGC26718
Origin species: Human
Product name: MGC26718-similar to ankyrin repeat domain 20A Gene
Size: 2ug
Accessions: BC127726
Gene id: 440482
Gene description: similar to ankyrin repeat domain 20A
Synonyms: ankyrin repeat domain-containing protein 20A-like protein MGC26718; Putative ankyrin repeat domain-containing protein 20A-like protein MGC26718; MGC26718; ANKRD20A5; ankyrin repeat domain 20 family, member A5, pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagttgttcggcttcaggagccgcaggggccagacggtcctgggctccatagaccacctctacacgggttccgggtaccgaatccggtactcggaactgcagaagatccacaaggcagctgtcaagggcgacgctgcggagatggagcgctgtctggcgcgcaggagcggagaccttgacgccctggacaagcagcacagaactgctctacatttggcctgtgccagtggccatgtgaaagtggtcactctcctggttaacagaaaatgtcagattgatatctatgacaaagaaaatagaacgcctttgatacaggctgtccattgccaggaagaggcttgtgccgttattctgctggaacatggtgccaatccaaaccttaaggatatctacggcaacactgctctccattatgctgtgtatagtgagagcacctcactggcagaaaaactgcttttccatggtgaaaatattgaagcactggacaaggtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - glutathione S-transferase mu 2 (muscle)
- GTP cyclohydrolase I feedback regulator
- complement component 8, gamma polypeptide
- rabphilin 3A-like (without C2 domains)

Reviews

Buy MGC26718-similar to ankyrin repeat domain 20A Gene now

Add to cart