Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PRSS1-protease, serine, 1 (trypsin 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRSS1-protease, serine, 1 (trypsin 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC128226 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRSS1 |
| Origin species: | Human |
| Product name: | PRSS1-protease, serine, 1 (trypsin 1) Gene |
| Size: | 2ug |
| Accessions: | BC128226 |
| Gene id: | 5644 |
| Gene description: | protease, serine, 1 (trypsin 1) |
| Synonyms: | TRP1; TRY1; TRY4; TRYP1; trypsin-1; TCR V beta 4.1; beta-trypsin; cationic trypsinogen; digestive zymogen; nonfunctional trypsin 1; trypsinogen 1; trypsinogen A; protease, serine 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatccattcctgatccttacctttgtggcagctgctcttgctgccccctttgatgatgatgacaagatcgttgggggctacaactgtgaggagaattctgtcccctaccaggtgtccctgaattctggctaccacttctgtggtggctccctcatcaacgaacagtgggtggtatcagcaggccactgctacaagtcccgcatccaggtgagactgggagagcacaacatcgaagtcctggaggggaatgagcagttcatcaatgcagccaagatcatccgccacccccaatacgacaggaagactctgaacaatgacatcatgttaatcaagctctcctcacgtgcagtaatcaacgcccgcgtgtccaccatctctctgcccaccgcccctccagccactggcacgaagtgcctcatctctggctggggcaacactgcgagctctggcgccgactacccagacgagctgcagtgcctggatgctcctgtgctgagccaggctaagtgtgaagcctcctaccctggaaagattaccagcaacatgttctgtgtgggcttccttgagggaggcaaggattcatgtcagggtgattctggtggccctgtggtctgcaatggacagctccaaggagttgtctcctggggtgatggctgtgcccagaagaacaagcctggagtctacaccaaggtctacaactatgtgaaatggattaagaacaccatagctgccaatagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 4C - spermatogenesis associated 12 - synovial sarcoma, X breakpoint 1 - matrix-remodelling associated 7 |