Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MXRA7-matrix-remodelling associated 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MXRA7-matrix-remodelling associated 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC053983 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MXRA7 |
| Origin species: | Human |
| Product name: | MXRA7-matrix-remodelling associated 7 Gene |
| Size: | 2ug |
| Accessions: | BC053983 |
| Gene id: | 439921 |
| Gene description: | matrix-remodelling associated 7 |
| Synonyms: | PS1TP1; TMAP1; matrix-remodeling-associated protein 7; HBV PreS1-transactivated protein 1; matrix-remodelling associated 7; transmembrane anchor protein 1; matrix remodeling associated 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgccggccgagctactggccgcgctgcctgcgctggccaccgcgctggcccttctgctcgcctggctactggtgcggcgtggggcggccgcgagcccggagcctgcccgcgcgcccccggaacccgcgcccccggccgaggccaccggggccccggcgccgtcccgcccctgcgcccccgagccggcggcctcgcccgcggggccggaggagcctggagagcccgcggggctgggggagctcggggagcctgcgggaccgggggagcccgaagggccaggggatcccgcggcggcgccagcggaggcggaggagcaggcggtggaggcgaggcaggaagaggagcaggacttggatggtgagaaggggccatcatcggaagggcctgaggaggaggacggagaaggcttctccttcaaatacagccccgggaagctgaggggaaaccagtacaagaagatgatgaccaaagaggagctggaggaggagcagagaactgaagaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, AN1-type domain 1 - death associated protein-like 1 - non-protein coding RNA 164 - zinc ribbon domain containing 1 |