Cart 1 Product Products 121,50 € (empty)
-
1 x PITPNB-pho...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of PITPNA-phosphatidylinositol transfer protein, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PITPNA-phosphatidylinositol transfer protein, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC082976 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PITPNA |
| Origin species: | Human |
| Product name: | PITPNA-phosphatidylinositol transfer protein, alpha Gene |
| Size: | 2ug |
| Accessions: | BC082976 |
| Gene id: | 5306 |
| Gene description: | phosphatidylinositol transfer protein, alpha |
| Synonyms: | HEL-S-36; PI-TPalpha; PITPN; VIB1A; phosphatidylinositol transfer protein alpha isoform; PI-TP-alpha; epididymis secretory protein Li 36; ptdIns transfer protein alpha; ptdInsTP alpha; phosphatidylinositol transfer protein alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgctgctcaaggagtatcgagtaatcctgcctgtgtctgtagatgagtatcaagtggggcagctgtattctgtggctgaggccagtaaaaatgaaacgggtggtggcgaaggcgtggaggtcctggtgaatgagccctacgagaaggacggtgagaaaggccagtacacacacaagatctaccacctgcagagcaaagtacccacgtttgttcgaatgctggccccagagggagccctgaatatacacgagaaagcctggaatgcttacccctactgcagaaccgttattacaaatgagtacatgaaagaagactttctgattaaaattgaaacctggcacaaaccagatcttggcacgcaggagaatgtgcataagctggagcctgaggcgtggaaacacgtggaagccgtatatatagacattgcagatcgaagccaagtgctcagcaaggattacaaggcagaggaagacccagcaaaatttaaatctatcaaaacaggccgaggacccttgggccccaattggaagcaagagcttgtaaaccagaaggactgcccatatatgtgtgcatacaaactggtgaccgtcaagttcaagtggtggggcctgcagaacaaagtggagaacttcatccataagcaagagaggcgtctgtttacaaacttccacaggcagctgttctgttggctcgataagtgggttgacctgaccatggacgacattcgaaggatggaagaagagacgaagagacagctggatgaaatgagacaaaaggacccagtgaaaggaatgacagcagatgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heterochromatin protein 1, binding protein 3 - butyrophilin-like 2 (MHC class II associated) - N-terminal EF-hand calcium binding protein 2 - family with sequence similarity 72, member A |