Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
PTXBC080635
New product
Data sheet of PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC080635 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PMEPA1 |
| Origin species: | Human |
| Product name: | PMEPA1-prostate transmembrane protein, androgen induced 1 Gene |
| Size: | 2ug |
| Accessions: | BC080635 |
| Gene id: | 56937 |
| Gene description: | prostate transmembrane protein, androgen induced 1 |
| Synonyms: | STAG1; TMEPAI; protein TMEPAI; solid tumor-associated 1 protein; transmembrane, prostate androgen induced RNA; prostate transmembrane protein, androgen induced 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagctggagtttgttcagatcatcatcatcgtggtggtgatgatggtgatggtggtggtgatcacgtgcctgctgagccactacaagctgtctgcacggtccttcatcagctggcacagccaggggcggaggagagaagatgccctgtcctcagaaggatgcctgtggccctcggagagcacagtgtcaggcaacggaatcccagagccgcaggtctacgccccgcctcggcccaccgaccgcctggccgtgccgcccttcgcccagcgggagcgcttccaccgcttccagcccacctatccgtacctgcagcacgagatcgacctgccgcccaccatctcgctgtcggacggggaggagcccccaccctaccagggcccctgcaccctccagcttcgggaccccgagcagcagctggaactgaaccgggagtcggtgcgcgcacccccaaacagaaccatcttcgacagtgacctgatggatagtgccaggctgggcggcccctgcccccccagcagtaactcgggcatcagcgccacgtgctacggcagcggcgggcgcatggaggggccgccgcccacctacagcgaggtcatcggccactacccggggtcctccttccagcaccagcagagcagtgggccgccctccttgctggaggggacccggctccaccacacacacatcgcgcccctagagagcgcagccatctggagcaaagagaaggataaacagaaaggacaccctctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 7, subfamily C, member 1 - olfactory receptor, family 5, subfamily P, member 2 - olfactory receptor, family 2, subfamily S, member 2 - non-protein coding RNA 51 |