Cart 7 Product Products 826,20 € (empty)
-
1 x WDR13-WD...121,50 € -
1 x STXBP6-syn...113,40 € -
1 x C7orf61-ch...113,40 € -
1 x PRRT2-prol...121,50 € -
1 x GOSR2-golg...113,40 € -
1 x MSR1-macro...121,50 € -
1 x WBP1-WW...121,50 €
No products
To be determined Shipping
826,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 826,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 826,20 €
Data sheet of PRMT6-protein arginine methyltransferase 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRMT6-protein arginine methyltransferase 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC063446 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRMT6 |
| Origin species: | Human |
| Product name: | PRMT6-protein arginine methyltransferase 6 Gene |
| Size: | 2ug |
| Accessions: | BC063446 |
| Gene id: | 55170 |
| Gene description: | protein arginine methyltransferase 6 |
| Synonyms: | histone-arginine N-methyltransferase PRMT6; HRMT1L6; protein arginine N-methyltransferase 6; HMT1 hnRNP methyltransferase-like 6; heterogeneous nuclear ribonucleoprotein methyltransferase-like protein 6; protein arginine methyltransferase 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcgcggaccgcgtccgcaccgatgcctaccgcctgggtatccttcggaactgggcagcactgcgaggcaagacggtactggacgtgggcgcgggcaccggcattctgagcatcttctgtgcccaggccggggcccggcgcgtgtacgcggtagaggccagcgccatctggcaacaggcccgggaggtggtgcggttcaacgggctggaggaccgggtgcacgtcctgccgggaccagtggagactgtagagttgccggaacaggtggatgccatcgtgagcgagtggatgggctacggactcctgcacgagtccatgctgagctccgtcctccacgcgcgaaccaagtggctgaaggagggcggtcttctcctgccggcctccgccgagctcttcatagcccccatcagcgaccagatgctggaatggcgcctgggcttctggagccaggtgaagcagcactatggtgtggacatgagctgcctggagggcttcgccacgcgctgtctcatgggccactcggagatcgttgtgcagggattgtccggcgaggacgtgctggcccggccgcagcgctttgctcagctagagctctcccgcgccggcttggagcaggagctggaggccggagtgggcgggcgcttccgctgcagctgctatggctcggcgcccatgcatggctttgccatctggttccaggtgaccttccctggaggggagtcggagaaacccctggtgctgtccacctcgccttttcacccggccactcactggaaacaggcgctcctctacctgaacgagccggtgcaagtggagcaagacacggacgtttcaggagagatcacgctgctgccctcccgggacaacccccgtcgcctgcgcgtgctgctgcgctacaaagtgggagaccaggaggagaagaccaaagactttgccatggaggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - mitogen-activated protein kinase 10 - solute carrier family 15, member 3 - chromosome 9 open reading frame 37 - transcription factor A, mitochondrial |