Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TFAM-transcription factor A, mitochondrial Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFAM-transcription factor A, mitochondrial Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC126366 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFAM |
| Origin species: | Human |
| Product name: | TFAM-transcription factor A, mitochondrial Gene |
| Size: | 2ug |
| Accessions: | BC126366 |
| Gene id: | 7019 |
| Gene description: | transcription factor A, mitochondrial |
| Synonyms: | MTDPS15; MTTF1; MTTFA; TCF6; TCF6L1; TCF6L2; TCF6L3; transcription factor A, mitochondrial; mitochondrial transcription factor 1; mitochondrial transcription factor A; transcription factor 6; transcription factor 6-like 1; transcription factor 6-like 2 (mitochondrial transcription factor); transcription factor 6-like 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtttctccgaagcatgtggggcgtgctgagtgccctgggaaggtctggagcagagctgtgcaccggctgtggaagtcgactgcgctcccccttcagttttgtgtatttaccgaggtggttttcatctgtcttggcaagttgtccaaagaaacctgtaagttcttaccttcgattttctaaagaacaactacccatatttaaagctcagaacccagatgcaaaaactacagaactaattagaagaattgcccagcgttggagggaacttcctgattcaaagaaaaaaatatatcaagatgcttatagggcggagtggcaggtatataaagaagagataagcagatttaaagaacagctaactccaagtcagattatgtctttggaaaaagaaatcatggacaaacatttaaaaaggaaagctatgacaaaaaaaaaagagttaacactgcttggaaaaccaaaaagacctcgttcagcttataacgtttatgtagctgaaagattccaagaagctaagggtgattcaccgcaggaaaagctgaagactgtaaaggaaaactggaaaaatctgtctgactctgaaaaggaattatatattcagcatgctaaagaggacgaaactcgttatcataatgaaatgaagtcttgggaagaacaaatgattgaagttggacgaaaggatcttctacgtcgcacaataaagaaacaacgaaaatatggtgctgaggagtgttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 2 open reading frame 80 - chromosome 4 open reading frame 30 - mitochondrial ribosomal protein L47 - zinc finger protein 702 pseudogene |