Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KCNJ10-potassium inwardly-rectifying channel, subfamily J, member 10 Gene
PTXBC131627
New product
Data sheet of KCNJ10-potassium inwardly-rectifying channel, subfamily J, member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNJ10-potassium inwardly-rectifying channel, subfamily J, member 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131627 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNJ10 |
| Origin species: | Human |
| Product name: | KCNJ10-potassium inwardly-rectifying channel, subfamily J, member 10 Gene |
| Size: | 2ug |
| Accessions: | BC131627 |
| Gene id: | 3766 |
| Gene description: | potassium inwardly-rectifying channel, subfamily J, member 10 |
| Synonyms: | BIRK-10; KCNJ13-PEN; KIR1.2; SESAME; ATP-sensitive inward rectifier potassium channel 10; ATP-dependent inwardly rectifying potassium channel Kir4.1; glial ATP-dependent inwardly rectifying potassium channel KIR4.1; inward rectifier K(+) channel Kir1.2; inward rectifier K+ channel KIR1.2; potassium channel, inwardly rectifying subfamily J member 10; potassium inwardly-rectifying channel, subfamily J, member 10; potassium voltage-gated channel subfamily J member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgtcagttgccaaggtgtattacagtcagaccactcagacagaaagccggcccctaatgggcccagggatacgacggcggagagtcctgacaaaagatggtcgcagcaacgtgagaatggagcacattgccgacaagcgcttcctctacctcaaggacctgtggacaaccttcattgacatgcagtggcgctacaagcttctgctcttctctgcgacctttgcaggcacatggttcctctttggcgtggtgtggtatctggtagctgtggcacatggggacctgctggagctggaccccccggccaaccacaccccctgtgtggtacaggtgcacacactcactggagccttcctcttctcccttgaatcccaaaccaccattggctatggcttccgctacatcagtgaggaatgtccactggccattgtgcttcttattgcccagctggtgctcaccaccatcctggaaatcttcatcacaggtaccttcctggcgaagattgcccggcccaagaagcgggctgagaccattcgtttcagccagcatgcagttgtggcctcccacaatggcaagccctgcctcatgatccgagttgccaatatgcgcaaaagcctcctcattggctgccaggtgacaggaaaactgcttcagacccaccaaaccaaggaaggggagaacatccggctcaaccaggtcaatgtgactttccaagtagacacagcctctgacagccccttccttattctaccccttaccttctatcatgtggtagatgagaccagtcccttgaaagatctccctcttcgcagtggtgagggtgactttgagctggtgctgatcctaagtgggacagtggagtccaccagtgccacctgtcaggtgcgcacttcctacctgccagaggagatcctttggggctacgagttcacacctgccatctcactgtcagccagtggtaaatacatagctgactttagcctttttgaccaagttgtgaaagtggcctctcctagtggcctccgtgacagcactgtacgctacggagaccctgaaaagctcaagttggaggagtcattaagggagcaagctgagaaggagggcagtgcccttagtgtgcgcatcagcaatgtctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - low density lipoprotein receptor class A domain containing 3 - low density lipoprotein receptor class A domain containing 1 - family with sequence similarity 86, member A pseudogene - coagulation factor VII (serum prothrombin conversion accelerator) |