Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HTR3C-5-hydroxytryptamine (serotonin) receptor 3, family member C Gene
PTXBC131799
New product
Data sheet of HTR3C-5-hydroxytryptamine (serotonin) receptor 3, family member C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HTR3C-5-hydroxytryptamine (serotonin) receptor 3, family member C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC131799 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HTR3C |
| Origin species: | Human |
| Product name: | HTR3C-5-hydroxytryptamine (serotonin) receptor 3, family member C Gene |
| Size: | 2ug |
| Accessions: | BC131799 |
| Gene id: | 170572 |
| Gene description: | 5-hydroxytryptamine (serotonin) receptor 3, family member C |
| Synonyms: | 5-hydroxytryptamine receptor 3C; 5-HT3-C; 5-HT3C; 5-hydroxytryptamine (serotonin) receptor 3, family member C; 5-hydroxytryptamine (serotonin) receptor 3C, ionotropic; 5-hydroxytryptamine receptor 3 subunit C; serotonin receptor 3C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggagggtggcctgcaaggcagagtgccctcctctgcctcactgtcagtcttctgcttcaaggaagaggcgacgcttttaccatcaattgctcaggctttgaccagcatggggttgaccctgctgtcttccaagcagtgtttgacagaaaggccttccgtccattcaccaactacagcatccctacccgtgtcaacatctccttcaccctgtctgccatcctgggagtggatgcacagctccagctgctgacatcattcctgtggatggatttggtatgggacaatcctttcattaattggaacccaaaagagtgtgttggcatcaataaactcacagtattagctgaaaacctgtggctcccagacatcttcatcgtggaatccatggatgtggatcagacgccttccggtctcactgcctatatcagcagtgaaggtcgaattaagtatgataagccaatgagggtgaccagcatctgtaacctggacatcttctacttcccttttgaccaacagaactgtaccttcaccttcagttctttcctctacacagtggacagcatgctgctgggcatggacaaggaggtgtgggagatcacagacacgtctcgcaaagtcatccaaacccagggggagtgggagctcttgggcatcaacaaggccaccccaaagatgtccatgggcaacaacctatatgaccagatcatgttttatgtggccatcaggcgcaggccaagcctctacatcataaacctgctggtgcccagtagctttctggttgccattgatgccctcagcttctacctgccagcagagagcgagaatcgtgccccattcaagataacacttctgctgggctacaacgtcttcctgctcatgatgaatgacttgctccctgccagtggcacccccctcatcagtgtctacttcgccctgtgcctgtccctgatggtggtcagcctgctggagaccgtcttcattacctacctgctgcacgtggccaccacccagcccccacccatgcctaggtggcttcactccctgctgctccactgcaccagcccagggagatgctgtcccactgcgccccagaagggaaataagggcctgggtctcaccctcacccacctgcctggcccaaaggagccgggggagttagcagggaagaagctgggacccagagagaccgagccagatgggggctcaggatggacaaagacccagctaatggagctgtgggtgcagttcagccacgcgatggacaccctgctcttccgcctctacctgctcttcatggcctcctccatccttactgtcattgtcctctggaacacctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane) - nudix (nucleoside diphosphate linked moiety X)-type motif 1 - COX19 cytochrome c oxidase assembly homolog (S. cerevisiae) - zinc finger, CCHC domain containing 9 |