SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene View larger

SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene


New product

Data sheet of SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC096327
Product type: DNA & cDNA
Ncbi symbol: SLC15A1
Origin species: Human
Product name: SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene
Size: 2ug
Accessions: BC096327
Gene id: 6564
Gene description: solute carrier family 15 (oligopeptide transporter), member 1
Synonyms: HPECT1; HPEPT1; PEPT1; solute carrier family 15 member 1; Caco-2 oligopeptide transporter; intestinal H+/peptide cotransporter; macrophage oligopeptide transporter PEPT1; oligopeptide transporter, small intestine isoform; peptide transporter 1; solute carrier family 15 (oligopeptide transporter), member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaatgtccaaatcacacagtttctttggttatcccctgagcatcttcttcatcgtggtcaatgagttttgcgaaagattttcctactatggaatgcgagcaatcctgattctgtacttcacaaatttcatcagctgggatgataacctgtccaccgccatctaccatacgtttgtggctctgtgctacctgacgccaattctcggagctcttatcgccgactcgtggctgggaaagttcaagaccattgtgtcgctctccattgtctacacaattggacaagcagtcacctcagtaagctccattaatgacctcacagaccacaaccatgatggcacccccgacagccttcctgtgcacgtggtgctgtccttgatcggcctggccctgatagctctcgggactggaggaatcaaaccctgtgtgtctgcgtttggtggagatcagtttgaagagggccaggagaaacaaagaaacagatttttttccatcttttacttggctattaatgctggaagtttgctttccacaatcatcacacccatgctcagagttcaacaatgtggaattcacagtaaacaagcttgttacccactggcctttggggttcctgctgctctcatggctgtagccctgattgtgtttgtccttggcagtgggatgtacaagaagttcaagccacagggcaacatcatgggtaaagtggccaagtgcatcggttttgccatcaaaaatagatttaggcatcggagtaaggcatttcccaagagggagcactggctggactgggctaaagagaaatacgatgagcggctcatctcccaaattaagatggttacgagggtgatgttcctgtatattccactcccaatgttctgggccttgtttgaccagcagggctccaggtggacactgcaggcaacaactatgtccgggaaaatcggagctgttgaaattcagcccgatcagatgcagaccgtgaacgccatcctgatcgtgatcatggtcccgatcttcgatgctgtgctgtaccctctcattgcaaaatgtggcttcaatttcacctccttgaagaagatggcagttggcatggtcctggcctccatggcctttgtggtggctgccatcgtgcaggtggaaatcgataaaactcttccagtcttccccaaaggaaacgaagtccaaattaaagttttgaatataggaaacaataccatgaatatatctcttcctggagagatggtgacacttggcccaatgtctcaaacaaatgcatttatgacttttgatgtaaacaaactgacaaggataaacatttcttctcctggatcaccagtcactgccgtaactgacgacttcaagcagggccaacgccacacgcttctagtgtgggcccccaatcactaccaggtggtaaaggatggtcttaaccagaagccagaaaaaggggaaaatggaatcagatttgtaaatacttttaacgagctcatcaccatcacaatgagtgggaaagtttatgcaaacatcagcagctacaatgccagcacataccagttttttccttctggcataaaaggcttcacaataagctcaacagagattccgccacaatgtcaacctaatttcaatactttctaccttgaatttggtagtgcttatacctatatagtccaaaggaagaatgacagctgccctgaagtgaaggtgtttgaagatatttcagccaacacagttaacatggctctgcaaatcccgcagtattttcttctcacctgtggcgaagtggtcttctctgtcacgggattggaattctcatattctcaggctccttccaacatgaagtcggtgcttcaggcaggatggctgctgaccgtggctgttggcaacatcattgtgctcatcgtggcaggggcaggccagttcagcaaacagtgggccgagtacattctatttgccgcgttgcttctggtcgtctgtgtaatttttgccatcatggctcggttctatacttacatcaacccagcggagatcgaagctcaatttgatgaggatgaaaagaaaaacagactggaaaagagtaacccatatttcatgtcaggggccaattcacagaaacagatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heat shock protein 90kDa alpha (cytosolic), class A member 1
- UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
- HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
- sperm antigen with calponin homology and coiled-coil domains 1

Buy SLC15A1-solute carrier family 15 (oligopeptide transporter), member 1 Gene now

Add to cart