HSP90AA1-heat shock protein 90kDa alpha (cytosolic), class A member 1 Gene View larger

HSP90AA1-heat shock protein 90kDa alpha (cytosolic), class A member 1 Gene

PTXBC121062

New product

Data sheet of HSP90AA1-heat shock protein 90kDa alpha (cytosolic), class A member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HSP90AA1-heat shock protein 90kDa alpha (cytosolic), class A member 1 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC121062
Product type: DNA & cDNA
Ncbi symbol: HSP90AA1
Origin species: Human
Product name: HSP90AA1-heat shock protein 90kDa alpha (cytosolic), class A member 1 Gene
Size: 2ug
Accessions: BC121062
Gene id: 3320
Gene description: heat shock protein 90kDa alpha (cytosolic), class A member 1
Synonyms: EL52; HEL-S-65p; HSP86; HSP89A; HSP90A; HSP90N; HSPC1; HSPCA; HSPCAL1; HSPCAL4; HSPN; Hsp103; Hsp89; LAP-2; LAP2; heat shock protein HSP 90-alpha; HSP 86; LPS-associated protein 2; epididymis luminal secretory protein 52; epididymis secretory sperm binding protein Li 65p; heat shock 86 kDa; heat shock 90kD protein 1, alpha; heat shock 90kD protein 1, alpha-like 4; heat shock 90kD protein, alpha-like 4; heat shock 90kDa protein 1, alpha; heat shock protein 90kDa alpha (cytosolic), class A member 1; heat shock protein 90kDa alpha family class A member 1; lipopolysaccharide-associated protein 2; renal carcinoma antigen NY-REN-38; heat shock protein 90 alpha family class A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctgaggaaacccagacccaagaccaaccgatggaggaggaggaggttgagacgttcgcctttcaggcagaaattgcccagttgatgtcattgatcatcaatactttctactcgaacaaagagatctttctgagagagctcatttcaaattcatcagatgcattggacaaaatccggtatgaaagcttgacagatcccagtaaattagactctgggaaagagctgcatattaaccttataccgaacaaacaagatcgaactctcactattgtggatactggaattggaatgaccaaggctgacttgatcaataaccttggtactatcgccaagtctgggaccaaagcgttcatggaagctttgcaggctggtgcagatatctctatgattggccagttcggtgttggtttttattctgcttatttggttgctgagaaagtaactgtgatcaccaaacataacgatgatgagcagtacgcttgggagtcctcagcagggggatcattcacagtgaggacagacacaggtgaacctatgggtcgtggaacaaaagttatcctacacctgaaagaagaccaaactgagtacttggaggaacgaagaataaaggagattgtgaagaaacattctcagtttattggatatcccattactctttttgtggagaaggaacgtgataaagaagtaagcgatgatgaggctgaagaaaaggaagacaaagaagaagaaaaagaaaaagaagagaaagagtcggaagacaaacctgaaattgaagatgttggttctgatgaggaagaagaaaagaaggatggtgacaagaagaagaagaagaagattaaggaaaagtacatcgatcaagaagagctcaacaaaacaaagcccatctggaccagaaatcccgacgatattactaatgaggagtacggagaattctataagagcttgaccaatgactgggaagatcacttggcagtgaagcatttttcagttgaaggacagttggaattcagagcccttctatttgtcccacgacgtgctccttttgatctgtttgaaaacagaaagaaaaagaacaatatcaaattgtatgtacgcagagttttcatcatggataactgtgaggagctaatccctgaatatctgaacttcattagaggggtggtagactcggaggatctccctctaaacatatcccgtgagatgttgcaacaaagcaaaattttgaaagttatcaggaagaatttggtcaaaaaatgcttagaactctttactgaactggcggaagataaagagaactacaagaaattctatgagcagttctctaaaaacataaagcttggaatacacgaagactctcaaaatcggaagaagctttcagagctgttaaggtactacacatctgcctctggtgatgagatggtttctctcaaggactactgcaccagaatgaaggagaaccagaaacatatctattatatcacaggtgagaccaaggaccaggtagctaactcagcctttgtggaacgtcttcggaaacatggcttagaagtgatctatatgattgagcccattgatgagtactgtgtccaacagctgaaggaatttgaggggaagactttagtgtcagtcaccaaagaaggcctggaacttccagaggatgaagaagagaaaaagaagcaggaagagaaaaaaacaaagtttgagaacctctgcaaaatcatgaaagacatattggagaaaaaagttgaaaaggtggttgtgtcaaaccgattggtgacatctccatgctgtattgtcacaagcacatatggctggacagcaaacatggagagaatcatgaaagctcaagccctaagagacaactcaacaatgggttacatggcagcaaagaaacacctggagataaaccctgaccattccattattgagaccttaaggcaaaaggcagaggctgataagaacgacaagtctgtgaaggatctggtcatcttgctttatgaaactgcgctcctgtcttctggcttcagtctggaagatccccagacacatgctaacaggatctacaggatgatcaaacttggtctgggtattgatgaagatgaccctactgctgatgataccagtgctgctgtaactgaagaaatgccaccccttgaaggagatgacgacacatcacgcatggaagaagtagactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
- HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2
- sperm antigen with calponin homology and coiled-coil domains 1
- glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase