RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene View larger

RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene


New product

Data sheet of RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC098269
Product type: DNA & cDNA
Ncbi symbol: RAP1GDS1
Origin species: Human
Product name: RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene
Size: 2ug
Accessions: BC098269
Gene id: 5910
Gene description: RAP1, GTP-GDP dissociation stimulator 1
Synonyms: GDS1; SmgGDS; rap1 GTPase-GDP dissociation stimulator 1; RAP1, GTP-GDP dissociation stimulator 1; SMG GDS protein; SMG P21 stimulatory GDP/GTP exchange protein; exchange factor smgGDS
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagataatctcagtgataccttgaagaagctgaagataacagctgttgacaagactgaggatagtttagaaggatgcttggattgtctgcttcaagccctggctcaaaataatacggaaacaagtgaaaaaatccaagcaagtggaatacttcagctgtttgcaagtctgttgactccacagtcttcctgcaaagccaaagtagctaacatcatagcagaagtagccaaaaatgagtttatgcgaattccatgtgtggatgctggattgatttcaccactggtgcagctgctaaatagcaaagaccaggaagtgctgcttcaaacgggcagggctctaggaaacatatgttacgatagccatgagggcagaagtgcagttgaccaagcaggtggtgcacagattgtaattgaccatttaaggtcactgtgcagtataacagatcccgccaatgagaagctcttgactgtcttttgtggcatgctgatgaactatagcaatgagaatgattcgcttcaagctcagcttatcaatatgggtgttattcctaccttagtgaaattactgggcatccactgccaaaatgcagctcttacagaaatgtgtcttgttgcatttggtaatttagcagaacttgagtcaagtaaagaacagtttgccagtacaaacattgctgaagagctagtaaaactcttcaagaaacaaataggacatgataagagagaaatgatttttgaagttcttgctccattggcagaaaatgatgctattaaactacagctggttgaagcaggcctagtagagtgtctactagagattgttcagcaaaaagtggatagtgacaaagaagatgatattactgagctcaaaactggttcagatctcatggttttattacttcttggagatgaatccatgcagaagttatttgaaggaggaaaaggtagtgtatttcaaagggtactctcttggatcccatcaaataaccaccagctacagcttgctggagcattggcaattgcaaattttgccagaaatgatgcaaattgtattcatatggtagacaatgggattgtagaaaaacttatggatttactggacagacatgtagaagatggaaatgtaacagtacagcatgcagcactaagtgccctcagaaacctggccattccagttataaataaagcaaagatgttatcagctggggtcacagaggcagttttgaaatttcttaaatctgaaatgcctcctgttcagttcaaacttctgggaacattaagaatgttaatagatgcacaagcagaagctgctgaacaattgggaaagaatgttaagttagtggagcgtttggtggaatggtgtgaagccaaagatcatgctggtgtgatgggggagtcaaacagactgctgtctgcccttatacgacacagtaaatcaaaagatgtaattaaaaccattgtgcagagtggtggcatcaagcatctagttaccatggcaactagtgaacatgtaataatgcagaatgaagctcttgttgctttggcattaatagcagctttagaattgggcactgctgagaaagatctagaaagtgctaaacttgtacagattttacatagactgctagcagatgagagaagtgctcctgaaatcaaatataattccatggtcctgatatgtgctcttatgggatctgaatgtctacacaaggaagtacaggatttggcttttctagatgtcgtatccaaacttcgcagtcatgagaacaaaagtgttgcccagcaggcctctctcacagagcagagacttactgtggaaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sodium channel, nonvoltage-gated 1, delta
- CSE1 chromosome segregation 1-like (yeast)
- CAP-GLY domain containing linker protein 1
- chromodomain helicase DNA binding protein 1

Buy RAP1GDS1-RAP1, GTP-GDP dissociation stimulator 1 Gene now

Add to cart