SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene View larger

SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene


New product

Data sheet of SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC125074
Product type: DNA & cDNA
Ncbi symbol: SCNN1D
Origin species: Human
Product name: SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene
Size: 2ug
Accessions: BC125074
Gene id: 6339
Gene description: sodium channel, nonvoltage-gated 1, delta
Synonyms: ENaCd; ENaCdelta; SCNED; dNaCh; amiloride-sensitive sodium channel subunit delta; delta-ENaC; delta-NaCH; epithelial Na(+) channel subunit delta; nonvoltage-gated sodium channel 1 subunit delta; sodium channel, non-voltage-gated 1, delta subunit; sodium channel, nonvoltage-gated 1, delta; sodium channel, voltage-gated, type I, delta polypeptide; sodium channel epithelial 1 delta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgagcaccgaagcatggacgggagaatggaagcagccacacgggggggctctcacctccaggctgcagcccagacgccccccaggccggggccaccatcagcaccaccaccaccacccaaggaggggcaccaggaggggctggtggagctgcccgcctcgttccgggagctgctcaccttcttctgcaccaatgccaccatccacggcgccatccgcctggtctgctcccgcgggaaccgcctcaagacgacgtcctgggggctgctgtccctgggagccctggtcgcgctctgctggcagctggggctcctctttgagcgtcactggcaccgcccggtcctcatggccgtctctgtgcactcggagcgcaagctgctcccgctggtcaccctgtgtgacgggaacccacgtcggccgagtccggtcctccgccatctggagctgctggacgagtttgccagggagaacattgactccctgtacaacgtcaacctcagcaaaggcagagccgccctctccgccactgtcccccgccacgagccccccttccacctggaccgggagatccgtctgcagaggctgagccactcgggcagccgggtcagagtggggttcagactgtgcaacagcacgggcggcgactgcttttaccgaggctacacgtcaggcgtggcggctgtccaggactggtaccacttccactatgtggatatcctggccctgctgcccgcggcatgggaggacagccacgggagccaggacggccacttcgtcctctcctgcagttacgatggcctggactgccaggcccgacagttccggaccttccaccaccccacctacggcagctgctacacggtcgatggcgtctggacagctcagcgccccggcatcacccacggagtcggcctggtcctcagggttgagcagcagcctcacctccctctgctgtccacgctggccggcatcagggtcatggttcacggccgtaaccacacgcccttcctggggcaccacagcttcagcgtccggccagggacggaggccaccatcagcatccgagaggacgaggtgcaccggctcgggagcccctacggccactgcaccgccggcggggaaggcgtggaggtggagctgctacacaacacctcctacaccaggcaggcctgcctggtgtcctgcttccagcagctgatggtggagacctgctcctgtggctactacctccaccctctgccggcgggggctgagtactgcagctctgcccggcaccctgcctggggacactgcttctaccgcctctaccaggacctggagacccaccggctcccctgtacctcccgctgccccaggccctgcagggagtctgcattcaagctctccactgggacctccaggtggccttccgccaagtcagctggatggactctggccacgctaggtgaacaggggctgccgcatcagagccacagacagaggagcagcctggccaaaatcaacatcgtctaccaggagctcaactaccgctcagtggaggaggcgcccgtgtactcggtgccgcagctgctctcggccatgggcagcctctgcagcctgtggtttggggcctccgtcctctccctcctggagctcctggagctgctgctcgatgcttctgccctcaccctggtgctaggcggccgccggctccgcagggcgtggttctcctggcccagagccagccctgcctcaggggcgtccagcatcaagccagaggccagtcagatgcccccgcctgcaggcggcacgtcagatgacccggagcccagcgggcctcatctcccacgggtgatgcttccaggggttctggcgggagtctcagccgaagagagctgggctgggccccagccccttgagactctggacacctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CSE1 chromosome segregation 1-like (yeast)
- CAP-GLY domain containing linker protein 1
- chromodomain helicase DNA binding protein 1
- myosin, heavy chain 7, cardiac muscle, beta

Buy SCNN1D-sodium channel, nonvoltage-gated 1, delta Gene now

Add to cart