Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC2A1-solute carrier family 2 (facilitated glucose transporter), member 1 Gene
PTXBC121804
New product
Data sheet of SLC2A1-solute carrier family 2 (facilitated glucose transporter), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A1-solute carrier family 2 (facilitated glucose transporter), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC121804 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A1 |
| Origin species: | Human |
| Product name: | SLC2A1-solute carrier family 2 (facilitated glucose transporter), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC121804 |
| Gene id: | 6513 |
| Gene description: | solute carrier family 2 (facilitated glucose transporter), member 1 |
| Synonyms: | CSE; DYT17; DYT18; DYT9; EIG12; GLUT; GLUT-1; GLUT1DS; HTLVR; PED; SDCHCN; solute carrier family 2, facilitated glucose transporter member 1; choreoathetosis/spasticity, episodic (paroxysmal choreoathetosis/spasticity); glucose transporter type 1, erythrocyte/brain; hepG2 glucose transporter; human T-cell leukemia virus (I and II) receptor; receptor for HTLV-1 and HTLV-2; solute carrier family 2 (facilitated glucose transporter), member 1; solute carrier family 2 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcccagcagcaagaagctgacgggtcgcctcatgctggccgtgggaggagcagtgcttggctccctgcagtttggctacaacactggagtcatcaatgccccccagaaggtgatcgaggagttctacaaccagacatgggtccaccgctatggggagagcatcctgcccaccacgctcaccacgctctggtccctctcagtggccatcttttctgttgggggcatgattggctccttctctgtgggccttttcgttaaccgctttggccggcggaattcaatgctgatgatgaacctgctggccttcgtgtccgccgtgctcatgggcttctcgaaactgggcaagtcctttgagatgctgatcctgggccgcttcatcatcggtgtgtactgtggcctgaccacaggcttcgtgcccatgtatgtgggtgaagtgtcacccacagcccttcgtggggccctgggcaccctgcaccagctgggcatcgtcgtcggcatcctcatcgcccaggtgttcggcctggactccatcatgggcaacaaggacctgtggcccctgctgctgagcatcatcttcatcccggccctgctgcagtgcatcgtgctgcccttctgccccgagagtccccgcttcctgctcatcaaccgcaacgaggagaaccgggccaagagtgtgctaaagaagctgcgcgggacagctgacgtgacccatgacctgcaggagatgaaggaagagagtcggcagatgatgcgggagaagaaggtcaccatcctggagctgttccgctcccccgcctaccgccagcccatcctcatcgctgtggtgctgcagctgtcccagcagctgtctggcatcaacgctgtcttctattactccacgagcatcttcgagaaggcgggggtgcagcagcctgtgtatgccaccattggctccggtatcgtcaacacggccttcactgtcgtgtcgctgtttgtggtggagcgagcaggccggcggaccctgcacctcataggcctcgctggcatggcgggttgtgccatactcatgaccatcgcgctagcactgctggagcagctaccccggatgtcctatctgagcatcgtggccatctttggctttgtggccttctttgaagtgggtcctggccccatcccatggttcatcgtggctgaactcttcagccagggtccacgtccagctgccattgccgttgcaggcttctccaactggacctcaaatttcattgtgggcatgtgcttccagtatgtggagcaactgtgtggtccctacgtcttcatcatcttcactgtgctcctggttctgttcttcatcttcacctacttcaaagttcctgagactaaaggccggaccttcgatgagatcgcttccggcttccggcaggggggagccagccaaagtgacaagacacccgaggagctgttccatcccctgggggctgattcccaagtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 4, sodium bicarbonate cotransporter, member 5 - membrane associated guanylate kinase, WW and PDZ domain containing 3 - solute carrier family 2 (facilitated glucose transporter), member 9 - solute carrier family 2 (facilitated glucose transporter), member 4 |