Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KLRB1-killer cell lectin-like receptor subfamily B, member 1 Gene
PTXBC114516
New product
Data sheet of KLRB1-killer cell lectin-like receptor subfamily B, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRB1-killer cell lectin-like receptor subfamily B, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC114516 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRB1 |
| Origin species: | Human |
| Product name: | KLRB1-killer cell lectin-like receptor subfamily B, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC114516 |
| Gene id: | 3820 |
| Gene description: | killer cell lectin-like receptor subfamily B, member 1 |
| Synonyms: | CD161; CLEC5B; NKR; NKR-P1; NKR-P1A; NKRP1A; hNKR-P1A; killer cell lectin-like receptor subfamily B member 1; C-type lectin domain family 5 member B; killer cell lectin-like receptor subfamily B, member 1; natural killer cell surface protein P1A; killer cell lectin like receptor B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccaacaagcaatatatgctgagttaaacttacccacagactcaggcccagaaagttcttcaccttcatctcttcctcgggatgtctgtcagggttcaccttggcatcaatttgccctgaaacttagctgtgctgggattattctccttgtcttggttgttactgggttgagtgtttcagtgacatccttaatacagaaatcatcaatagaaaaatgcagtgtggacattcaacagagcaggaataaaacaacagagagaccgggtctcttaaactgcccaatatattggcagcaactccgagagaaatgcttgttattttctcacactgtcaacccttggaataacagtctagctgattgttccaccaaagaatccagcctgctgcttattcgagataaggatgaattgatacacacacagaacctgatacgtgacaaagcaattctgttttggattggattaaatttttcattatcagaaaagaactggaagtggataaacggctcttttttaaattctaatgacttagaaattagaggtgatgctaaagaaaacagctgtatttccatctcacagacatctgtgtattctgagtactgtagtacagaaatcagatggatctgccaaaaagaactaacacctgtgagaaataaagtgtatcctgactcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - triggering receptor expressed on myeloid cells-like 2 - cytochrome P450, family 2, subfamily C, polypeptide 9 - Rap guanine nucleotide exchange factor (GEF)-like 1 - cytochrome P450, family 2, subfamily A, polypeptide 6 |