Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TREML2-triggering receptor expressed on myeloid cells-like 2 Gene
PTXBC125078
New product
Data sheet of TREML2-triggering receptor expressed on myeloid cells-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TREML2-triggering receptor expressed on myeloid cells-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125078 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TREML2 |
| Origin species: | Human |
| Product name: | TREML2-triggering receptor expressed on myeloid cells-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC125078 |
| Gene id: | 79865 |
| Gene description: | triggering receptor expressed on myeloid cells-like 2 |
| Synonyms: | C6orf76; TLT-2; TLT2; dJ238O23.1; trem-like transcript 2 protein; triggering receptor expressed on myeloid cells-like protein 2; triggering receptor expressed on myeloid cells like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatccctgcggttggctgggggcagtgggtcccacactgcctcacttccctaaatgggcagcttcacttttagaaccccggatccttccctggcaggcccaggtggcacatcctgtgtcgggtgggccctcaccttggatctccaggcctgacactgcccagctggatggaaccatggccccagccttcctgctgctgctgctgctgtggccacagggttgcgtctcaggcccctctgctgacagtgtatacacaaaagtgaggctccttgaaggggagactctgtctgtgcagtgctcctataagggctacaaaaaccgcgtggagggcaaggtttggtgcaaaatcaggaagaagaagtgtgagcctggctttgcccgagtctgggtgaaagggccccgctacttgctgcaggacgatgcccaggccaaggtggtcaacatcaccatggtggccctcaagctccaggactcaggccgatactggtgcatgcgcaatacctctgggatcctgtaccccttgatgggcttccagctggatgtgtctccagctccccaaagtgagaggaacattcctttcacacatctggacaacatcctcaagagtggaactgtcacaactggccaagcccctacctcaggccctgatgccccttttaccactggtgtgatggtgttcaccccaggactcatcaccttgcctaggctcttagcctccaccagacctgcctccaagacaggctacagcttcactgctaccagcaccaccagccagggacccaggaggaccatggggtcccagacagtgaccgcgtctcccagcaatgccagggactcctctgctggcccagaatccatctccactaagtctggggacctcagcaccagatcgcccaccacagggctctgcctcaccagcagatctctcctcaacagactaccctccatgccctccatcaggcaccaggatgtttactccactgtgcttggggtggtgctgaccctcctggtgctgatgctgatcatggtctatgggttttggaagaagagacacatggcaagctacagcatgtgcagcgatccttctacacgtgacccacctggaagaccagagccctatgtggaagtctacttgatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily C, polypeptide 9 - Rap guanine nucleotide exchange factor (GEF)-like 1 - cytochrome P450, family 2, subfamily A, polypeptide 6 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 |