Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of ODF3L2-outer dense fiber of sperm tails 3-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ODF3L2-outer dense fiber of sperm tails 3-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC104469 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ODF3L2 |
| Origin species: | Human |
| Product name: | ODF3L2-outer dense fiber of sperm tails 3-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC104469 |
| Gene id: | 284451 |
| Gene description: | outer dense fiber of sperm tails 3-like 2 |
| Synonyms: | C19orf19; outer dense fiber protein 3-like protein 2; outer dense fiber of sperm tails 3 like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggaccctcagctgcgactccaccccacggctggccacagccccccttggccggcgagtgacggagggccagattccggagaccggcctgaggaagtcctgtgggacggccaccctggagaacggctcggggccaggcttgtatgtcctgccgtccaccgtgggcttcatcaaccacgactgcaccagggtggccagtcccgcctactcgctcgtccggaggcccagtgaggcaccacctcaggacaccagcccgggccccatctacttcttggaccccaaagtcacacgctttggccgcagctgcacccctgcctactccatgcagggccgggccaagtctcggggtccggaggtgacgccaggccctggggcctacagcccagagaaggtgccccctgcgcgccatcggacaccgccggctttcaccctgggctgccgcctccccctgaagcccctggacacctcagcccctgcccctaatgcctacaccatgccccctctgtggggctcacagatcttcaccaagcccagcagccccagctacacggtggtgggccgcaccccccccgcccgccccccgcaggatcctgctgagataccaggcccgggccagtacgacagcccggacgcaaacacctaccgccagcgcctgcctgccttcaccatgctggggcggccccgggccccgcgacccctggaggagacccccggccctggcgcccactgcccagagcaggtcaccgtgaacaaagccagggctccagcgttctctatgggcatccgccactcgaaacgggccagcaccatggccgccaccacgccctcccggcctgcggggcacaggctgcccggccgctgctgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycosyltransferase 8 domain containing 1 - male-specific lethal 1 homolog (Drosophila) - interleukin-1 receptor-associated kinase 2 - RAP1, GTP-GDP dissociation stimulator 1 |