Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ANP32A-acidic (leucine-rich) nuclear phosphoprotein 32 family, member A Gene
PTXBC125143
New product
Data sheet of ANP32A-acidic (leucine-rich) nuclear phosphoprotein 32 family, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ANP32A-acidic (leucine-rich) nuclear phosphoprotein 32 family, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125143 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ANP32A |
| Origin species: | Human |
| Product name: | ANP32A-acidic (leucine-rich) nuclear phosphoprotein 32 family, member A Gene |
| Size: | 2ug |
| Accessions: | BC125143 |
| Gene id: | 8125 |
| Gene description: | acidic (leucine-rich) nuclear phosphoprotein 32 family, member A |
| Synonyms: | C15orf1; HPPCn; I1PP2A; LANP; MAPM; PHAP1; PHAPI; PP32; acidic leucine-rich nuclear phosphoprotein 32 family member A; acidic (leucine-rich) nuclear phosphoprotein 32 family, member A; acidic nuclear phosphoprotein pp32; cerebellar leucine rich acidic nuclear protein; hepatopoietin Cn; inhibitor-1 of protein phosphatase-2A; leucine-rich acidic nuclear protein; mapmodulin; potent heat-stable protein phosphatase 2A inhibitor I1PP2A; acidic nuclear phosphoprotein 32 family member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatgggcagacggattcatttagagctgcggaacaggacgccctctgatgtgaaagaacttgtcctggacaacagtcggtcgaatgaaggcaaactcgaaggcctcacagatgaatttgaagaactggaattcttaagtacaatcaacgtaggcctcacctcaatcgcaaacttaccaaagttaaacaaacttaagaagcttgaactaagcgataacagagtctcagggggcctggaagtattggcagaaaagtgtccgaacctcacgcatctaaatttaagtggcaacaaaattaaagacctcagcacaatagagccactgaaaaagttagaaaacctcaagagcttagaccttttcaattgcgaggtaaccaacctgaacgactaccgagaaaatgtgttcaagctcctcccgcaactcacatatctcgacggctatgaccgggacgacaaggaggcccctgactcggatgctgagggctacgtggagggcctggatgatgaggaggaggatgaggatgaggaggagtatgatgaagatgctcaggtagtggaagacgaggaggacgaggatgaggaggaggaaggtgaagaggaggacgtgagtggagaggaggaggaggatgaagaaggttataacgatggagaggtagatgacgaggaagatgaagaagagcttggtgaagaagaaaggggtcagaagcgaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TEA domain family member 1 (SV40 transcriptional enhancer factor) - Bartter syndrome, infantile, with sensorineural deafness (Barttin) - kinase insert domain receptor (a type III receptor tyrosine kinase) - solute carrier family 5 (sodium/glucose cotransporter), member 2 |