Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TEAD1-TEA domain family member 1 (SV40 transcriptional enhancer factor) Gene
PTXBC115398
New product
Data sheet of TEAD1-TEA domain family member 1 (SV40 transcriptional enhancer factor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TEAD1-TEA domain family member 1 (SV40 transcriptional enhancer factor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC115398 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TEAD1 |
| Origin species: | Human |
| Product name: | TEAD1-TEA domain family member 1 (SV40 transcriptional enhancer factor) Gene |
| Size: | 2ug |
| Accessions: | BC115398 |
| Gene id: | 7003 |
| Gene description: | TEA domain family member 1 (SV40 transcriptional enhancer factor) |
| Synonyms: | NTEF-1; REF1; TCF-13; TCF13; TEAD-1; TEF-1; transcriptional enhancer factor TEF-1; TEA domain family member 1 (SV40 transcriptional enhancer factor); protein GT-IIC; transcription factor 13; transcriptional enhancer factor 1; TEA domain transcription factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaaggatgagtgactctgcagataagccaattgacaatgatgcagaaggggtctggagccccgacatcgagcaaagctttcaggaggccctggctatctatccaccatgtgggaggaggaaaatcatcttatcagacgaaggcaaaatgtatggtaggaatgaattgatagccagatacatcaaactcaggacaggcaagacgaggaccagaaaacaggtgtctagtcacattcaggttcttgccagaaggaaatctcgtgattttcattccaagctaaaggtaacaagcatggatcagactgcaaaggataaggccctgcagcacatggcggccatgtcctcagcccagatcgtctcggccactgccattcataacaagctggggctgcctgggattccacgcccgaccttcccaggggcgccggggttctggccgggaatgattcaaacagggcagccaggatcctcacaagacgtcaagccttttgtgcagcaggcctaccccatccagccagcggtcacagcccccattccagggtttgagcctgcatcggccccagctccctcagtccctgcctggcaaggtcgctccattggcacaaccaagcttcgcctggtggaattttcagcttttctcgagcagcagcgagacccagactcggctgatttaaactgcaatattcaagatgatgctggggctttttatggtgtaaccagtcagtacgagagttctgaaaatatgacagtcacctgttccaccaaagtttgctcctttgggaagcaagtagtagaaaaagtagagacggagtatgcaaggtttgagaatggccgatttgtataccgaataaaccgctccccaatgtgtgaatatatgatcaacttcatccacaagctcaaacacttaccagagaaatatatgatgaacagtgttttggaaaacttcacaattttattggtggtaacaaacagggatacacaagaaactctactctgcatggcctgtgtgtttgaagtttcaaatagtgaacacggagcacaacatcatatttacaggcttgtaaaggactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Bartter syndrome, infantile, with sensorineural deafness (Barttin) - kinase insert domain receptor (a type III receptor tyrosine kinase) - solute carrier family 5 (sodium/glucose cotransporter), member 2 - transmembrane phosphoinositide 3-phosphatase and tensin homolog 2 |