Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
PTXBC098336
New product
Data sheet of KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098336 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KDELR3 |
| Origin species: | Human |
| Product name: | KDELR3-KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC098336 |
| Gene id: | 11015 |
| Gene description: | KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 |
| Synonyms: | ERD2L3; ER lumen protein-retaining receptor 3; KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3; KDEL receptor 3; KDEL endoplasmic reticulum protein retention receptor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgtgttccgaatcctcggcgacctgagccacctcctggccatgatcttgctgctggggaagatctggaggtccaagtgctgcaagggcatctctgggaagagccagatcctgtttgctctcgtcttcaccaccaggtacctggacctgttcaccaacttcatctccatctacaacacagtaatgaaggtggtttttctcctctgtgcctatgttacagtgtacatgatatatgggaaattccgtaaaacttttgacagtgagaatgacacattccgcctggagtttcttctggtcccagtcattggcctttccttccttgaaaactacagtttcactctgctggagatcctctggactttctctatctatctggaatcagtggctatcctgccccagctcttcatgatcagcaagactggagaggctgagaccataactactcactacctgttctttctgggtctgtaccgggcactctacctggctaactggatcaggcggtaccagactgagaatttctatgaccaaattgcagtcgtgtctggagtagtacaaaccatcttctactgtgacttcttctacttgtatgggaccaaaggtaggtcctgggatgacagcaatgctgacactggcctaaggagttactcatccatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 6 (neurotransmitter transporter, glycine), member 5 - protein (peptidylprolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) - leucine rich repeat (in FLII) interacting protein 1 - Ras association (RalGDS/AF-6) domain family member 4 |