Cart 12 Product Products 1 382,87 € (empty)
-
1 x GSTZ1-glut...113,40 € -
1 x BRE-brain...121,50 € -
1 x SSX3-synov...113,40 € -
-
1 x NKAP-NFKB...121,50 € -
1 x SPOCK3-spa...121,50 € -
1 x FAM71E2-fa...113,40 € -
1 x MAGEA6-mel...121,50 € -
1 x C8orf68-ch...113,40 € -
-
-
1 x PEX3-perox...121,50 €
No products
To be determined Shipping
1 382,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 382,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 382,87 €
Data sheet of LOC284749-hypothetical protein LOC284749 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOC284749-hypothetical protein LOC284749 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC122555 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOC284749 |
| Origin species: | Human |
| Product name: | LOC284749-hypothetical protein LOC284749 Gene |
| Size: | 2ug |
| Accessions: | BC122555 |
| Gene id: | 284749 |
| Gene description: | hypothetical protein LOC284749 |
| Synonyms: | long intergenic non-protein coding RNA 494 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcatggaaatgctgtgtggagtgagctaagcagccgttctcaggagaaaacagacaaatcctcctgcatcctggcaaaccagctttgtggcctgttttatgtcatctttgctgagctccaccgggtcacccctcctgttggctttgtgatactgacatttcaggcactggcacagatacattggccttcctggctgggatttcacggacggagtgagcagtgctggcttggaggagccgtggcggcacagggcctgtgctctcagctgatcaacgccttgatagccaggaaaggcctgtcctaccccaaagggccctcgcagcactgtttgaaattgctcttgccatctttggaatggattcctcagtacatttcagactcgttgttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - R-spondin homolog (Xenopus laevis) - FLJ40296 protein family member - interleukin 22 receptor, alpha 2 - GC-rich promoter binding protein 1 |