Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL22RA2-interleukin 22 receptor, alpha 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL22RA2-interleukin 22 receptor, alpha 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125167 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL22RA2 |
| Origin species: | Human |
| Product name: | IL22RA2-interleukin 22 receptor, alpha 2 Gene |
| Size: | 2ug |
| Accessions: | BC125167 |
| Gene id: | 116379 |
| Gene description: | interleukin 22 receptor, alpha 2 |
| Synonyms: | CRF2-10; CRF2-S1; CRF2X; IL-22BP; IL-22R-alpha-2; IL-22RA2; ZCYTOR16; interleukin-22 receptor subunit alpha-2; cytokine receptor class-II member 10; cytokine receptor family type 2, soluble 1; interleukin 22 receptor, alpha 2; interleukin 22-binding protein; interleukin 22 receptor subunit alpha 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgcctaaacattgctttctaggcttcctcatcagtttcttccttactggtgtagcaggaactcagtcaacgcatgagtctctgaagcctcagagggtacaatttcagtcccgaaattttcacaacattttgcaatggcagcctgggagggcacttactggcaacagcagtgtctattttgtgcagtacaaaatatatggacagagacaatggaaaaataaagaagactgttggggtactcaagaactctcttgtgaccttaccagtgaaacctcagacatacaggaaccttattacgggagggtgagggcggcctcggctgggagctactcagaatggagcatgacgccgcggttcactccctggtgggaaacaaaaatagatcctccagtcatgaatataacccaagtcaatggctctttgttggtaattctccatgctccaaatttaccatatagataccaaaaggaaaaaaatgtatctatagaagattactatgaactactataccgagtttttataattaacaattcactagaaaaggagcaaaaggtttatgaaggggctcacagagcggttgaaattgaagctctaacaccacactccagctactgtgtagtggctgaaatatatcagcccatgttagacagaagaagtcagagaagtgaagagagatgtgtggaaattccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GC-rich promoter binding protein 1 - transmembrane protease, serine 5 - creatine kinase, mitochondrial 1B - RasGEF domain family, member 1B |