Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST1H2BD-histone cluster 1, H2bd Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST1H2BD-histone cluster 1, H2bd Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC096122 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST1H2BD |
| Origin species: | Human |
| Product name: | HIST1H2BD-histone cluster 1, H2bd Gene |
| Size: | 2ug |
| Accessions: | BC096122 |
| Gene id: | 3017 |
| Gene description: | histone cluster 1, H2bd |
| Synonyms: | H2B.1B; H2B/b; H2BFB; HIRIP2; dJ221C16.6; histone H2B type 1-D; H2B histone family, member B; HIRA-interacting protein 2; histone 1, H2bd; histone H2B.1 B; histone H2B.b; histone cluster 1, H2bd; histone cluster 1 H2B family member d |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcctgaacctgctaagtccgctcctgccccaaagaagggctccaagaaggcggtgactaaggctcagaagaaggacgggaagaagcgcaagcgcagccgcaaggagagctattcagtgtatgtgtacaaggtgctgaagcaggtccatcccgacaccggcatctcttccaaggcaatggggatcatgaattccttcgtcaacgacatcttcgagcgcatcgcaggcgaggcttcccgcctggcgcattacaacaagcgctcgaccatcacctccagggagatccagacggccgtgcgcctgctgcttccgggggagctggccaagcacgccgtgtcggagggcaccaaggccgtcaccaagtacaccagttccaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 3, H2bb - transmembrane protein 134 - troponin I type 3 (cardiac) - mortality factor 4 like 1 |