> >>TNNI3-troponin I type 3 (cardiac) Gene
TNNI3-troponin I type 3 (cardiac) Gene View larger

TNNI3-troponin I type 3 (cardiac) Gene

PTXBC096165

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of TNNI3-troponin I type 3 (cardiac) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNNI3-troponin I type 3 (cardiac) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC096165
Product type: DNA & cDNA
Ncbi symbol: TNNI3
Origin species: Human
Product name: TNNI3-troponin I type 3 (cardiac) Gene
Size: 2ug
Accessions: BC096165
Gene id: 7137
Gene description: troponin I type 3 (cardiac)
Synonyms: CMD1FF; CMD2A; CMH7; RCM1; TNNC1; cTnI; troponin I, cardiac muscle; cardiomyopathy, dilated 2A (autosomal recessive); troponin I type 3 (cardiac); troponin I3, cardiac type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggatgggagcagcgatgcggctagggaacctcgccctgcaccagccccaatcagacgccgctcctccaactaccgcgcttatgccacggagccgcacgccaagaaaaaatctaagatctccgcctcgagaaaattgcagctgaagactctgctgctgcagattgcaaagcaagagctggagcgagaggcggaggagcggcgcggagagaaggggcgcgctctgagcacccgctgccagccgctggagttggccgggctgggcttcgcggagctgcaggacttgtgccgacagctccacgcccgtgtggacaaggtggatgaagagagatacgacatagaggcaaaagtcaccaagaacatcacggagattgcagatctgactcagaagatctttgaccttcgaggcaagtttaagcggcccaccctgcggagagtgaggatctctgcagatgccatgatgcaggcgctgctgggggcccgggctaaggagtccctggacctgcgggcccacctcaagcaggtgaagaaggaggacaccgagaaggaaaaccgggaggtgggagactggcgcaagaacatcgatgcactgagtggaatggagggccgcaagaaaaagtttgagagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mortality factor 4 like 1
- BCL2-associated athanogene 2
- DPH1 homolog (S. cerevisiae)
- chromodomain protein, Y-like

Reviews

Buy TNNI3-troponin I type 3 (cardiac) Gene now

Add to cart