Cart 7 Product Products 826,20 € (empty)
-
1 x CHCHD7-coi...113,40 € -
1 x DEFB127-de...113,40 € -
1 x NDUFA10-NA...121,50 € -
1 x PIGO-phosp...121,50 € -
1 x SLC46A2-so...121,50 € -
1 x IL3-interl...113,40 € -
1 x CCNG1-cycl...121,50 €
No products
To be determined Shipping
826,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 826,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 826,20 €
Data sheet of FLJ36208-hypothetical protein FLJ36208 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ36208-hypothetical protein FLJ36208 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC113527 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ36208 |
| Origin species: | Human |
| Product name: | FLJ36208-hypothetical protein FLJ36208 Gene |
| Size: | 2ug |
| Accessions: | BC113527 |
| Gene id: | 283948 |
| Gene description: | hypothetical protein FLJ36208 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgggtctggagggcccctgctgggtgggcccagggcctgatgggggccttgctgtgagtgaggagtttggggatgtgaggctgtttggcagtgcccgccaacccctgggctccctggggggctggacggggcacactttcggctgcccagcgggcatctgctccaactcagagggcaatgttattgtggcagacgagcagaggcgccaggtgaccctgtttccccgggctgggccacccatctgcctggtgtcagaggggcttgggcagcccttgggagtggcctgtgcaccccagggccagctcctggtggctgatgccaaggacaactccatcaaggtgtaccagggcctcaaggagctggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dual specificity phosphatase 21 - SFRS12-interacting protein 1 - hypothetical protein FLJ13224 - hypothetical protein FLJ37201 |