Cart 3 Product Products 887,00 € (empty)
No products
To be determined Shipping
887,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 887,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 887,00 €
Data sheet of SFRS12IP1-SFRS12-interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFRS12IP1-SFRS12-interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC127085 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFRS12IP1 |
| Origin species: | Human |
| Product name: | SFRS12IP1-SFRS12-interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC127085 |
| Gene id: | 285672 |
| Gene description: | SFRS12-interacting protein 1 |
| Synonyms: | protein SFRS12IP1; SFRS12IP1; P18SRP; protein SREK1IP1; SFRS12-interacting protein 1; p18 splicing regulatory protein; splicing regulatory protein of 18 kDa; SREK1 interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagtcccaggttgcaacaaggacagtgtcagagcaggctgtaaaaaatgtggctaccctggtcacctgacttttgaatgccgcaattttctccgagtagaccctaaaagggacatagttttggatgtcagcagtacaagtagtgaagatagcgatgaagagaatgaagaactgaataaattgcaggcattacaggaaaaaagaataaatgaagaagaggaaaagaagaaagaaaaaagcaaagaaaaaatcaaattgaaaaaaaaaaggaaaaggtcttactcatccagttccactgaagaggacacttcaaaacaaaagaaacaaaaatatcagaagaaagaaaagaaaaaagaaaaaaagagtaaatcaaaaaaagggaaacatcacaaaaaggaaaaaaagaagagaaaaaaggaaaagcattcttctacacctaatagttctgaattctccagaaagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein FLJ13224 - hypothetical protein FLJ37201 - FK506 binding protein 1A, 12kDa - leucine rich repeat containing 3 |