Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V0E1-ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 Gene
PTXBC119714
New product
Data sheet of ATP6V0E1-ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V0E1-ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC119714 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V0E1 |
| Origin species: | Human |
| Product name: | ATP6V0E1-ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 Gene |
| Size: | 2ug |
| Accessions: | BC119714 |
| Gene id: | 8992 |
| Gene description: | ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1 |
| Synonyms: | ATP6H; ATP6V0E; M9.2; Vma21; Vma21p; V-type proton ATPase subunit e 1; ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1; H(+)-transporting two-sector ATPase, subunit H; V-ATPase 9.2 kDa membrane accessory protein; V-ATPase H subunit; V-ATPase M9.2 subunit; V-ATPase subunit e 1; vacuolar ATP synthase subunit H; vacuolar proton pump H subunit; vacuolar proton pump subunit e 1; vacuolar proton-ATPase subunit M9.2; ATPase H+ transporting V0 subunit e1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtatcacggcctcactgtgcctctcattgtgatgagcgtgttctggggcttcgtcggcttcttggtgccttggttcatccctaagggtcctaaccggggagttatcattaccatgttggtgacctgttcagtttgctgctatctcttttggctgattgcaattctggcccaactcaaccctctctttggaccgcaattgaaaaatgaaaccatctggtatctgaagtatcattggccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - major histocompatibility complex, class II, DQ alpha 1 - major histocompatibility complex, class II, DQ alpha 1 - docking protein 1, 62kDa (downstream of tyrosine kinase 1) - G protein-coupled receptor associated sorting protein 1 |