Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene
PTXBC125045
New product
Data sheet of HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC125045 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DQA1 |
| Origin species: | Human |
| Product name: | HLA-DQA1-major histocompatibility complex, class II, DQ alpha 1 Gene |
| Size: | 2ug |
| Accessions: | BC125045 |
| Gene id: | 3117 |
| Gene description: | major histocompatibility complex, class II, DQ alpha 1 |
| Synonyms: | CELIAC1; DQ-A1; HLA-DQA; HLA class II histocompatibility antigen, DQ alpha 1 chain; DC-1 alpha chain; DC-alpha; HLA-DCA; MHC HLA-DQ alpha; MHC class II DQA1; MHC class II HLA-DQ-alpha-1; major histocompatibility complex, class II, DQ alpha 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcctaaacaaagctctgatgctgggggccctcgccctgaccaccgtgatgagcccttgtggaggtgaagacattgtggctgaccacgttgcctcttacggtgtaaacttgtaccagtcttacggtccctctggccagttcacccatgaatttgatggagacgaggagttctatgtggacctggagaggaaggagactgtctggaagttgcctctgttccacagacttagatttgacccgcaatttgcactgacaaacatcgctgtgctaaaacataacttgaacatcctgattaaacgctccaactctaccgctgctaccaatgaggttcctgaggtcacagtgttttccaagtctcccgtgacactgggtcagcccaacaccctcatctgtcttgtggacaacatctttcctcctgtggtcaacatcacctggctgagcaatgggcactcagtcacagaaggtgtttctgagaccagcttcctctccaagagtgatcattccttcttcaagatcagttacctcaccttcctcccttctgctgatgagatttatgactgcaaggtggagcactggggcctggatgagcctcttctgaaacactgggagcctgagattccagcacctatgtcagagctcacagagactgtggtctgtgccctggggttgtctgtgggcctcgtgggcattgtggtggggaccgtcttgatcatccgaggcctgcgttcagttggtgcttccagacaccaagggcccttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - docking protein 1, 62kDa (downstream of tyrosine kinase 1) - G protein-coupled receptor associated sorting protein 1 - SLIT-ROBO Rho GTPase activating protein 2 pseudogene 1 - solute carrier family 39 (zinc transporter), member 12 |