Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BATF3-basic leucine zipper transcription factor, ATF-like 3 Gene
PTXBC117489
New product
Data sheet of BATF3-basic leucine zipper transcription factor, ATF-like 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BATF3-basic leucine zipper transcription factor, ATF-like 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC117489 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BATF3 |
| Origin species: | Human |
| Product name: | BATF3-basic leucine zipper transcription factor, ATF-like 3 Gene |
| Size: | 2ug |
| Accessions: | BC117489 |
| Gene id: | 55509 |
| Gene description: | basic leucine zipper transcription factor, ATF-like 3 |
| Synonyms: | JDP1; JUNDM1; SNFT; basic leucine zipper transcriptional factor ATF-like 3; 21 kDa small nuclear factor isolated from T-cells; 21-kD small nuclear factor isolated from T cells; B-ATF-3; Jun dimerization protein 1; Jun dimerization protein p21SNFT; basic leucine zipper transcription factor, ATF-like 3; basic leucine zipper ATF-like transcription factor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgcaagggctcccggccgccggcagcgtcctgcagaggagcgtcgcggcgcccgggaaccagccgcagccgcagccgcagcagcagagccctgaggatgatgacaggaaggtccgaaggagagaaaaaaaccgagttgctgctcagagaagtcggaagaagcagacccagaaggctgacaagctccatgaggaatatgagagcctggagcaagaaaacaccatgctgcggagagagatcgggaagctgacagaggagctgaagcacctgacagaggcactgaaggagcacgagaagatgtgcccgctgctgctctgccctatgaactttgtgccagtgcctccccggccggaccctgtggccggctgcttgccccgatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transcriptional adaptor 2 (ADA2 homolog, yeast)-beta - chaperonin containing TCP1, subunit 8 (theta)-like 2 - transforming, acidic coiled-coil containing protein 3 - leucine rich repeat (in FLII) interacting protein 1 |