Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TADA2B-transcriptional adaptor 2 (ADA2 homolog, yeast)-beta Gene
PTXBC101334
New product
Data sheet of TADA2B-transcriptional adaptor 2 (ADA2 homolog, yeast)-beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TADA2B-transcriptional adaptor 2 (ADA2 homolog, yeast)-beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101334 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TADA2B |
| Origin species: | Human |
| Product name: | TADA2B-transcriptional adaptor 2 (ADA2 homolog, yeast)-beta Gene |
| Size: | 2ug |
| Accessions: | BC101334 |
| Gene id: | 93624 |
| Gene description: | transcriptional adaptor 2 (ADA2 homolog, yeast)-beta |
| Synonyms: | ADA2(beta); ADA2B; transcriptional adapter 2-beta; ADA2-beta; ADA2-like protein beta; transcriptional adaptor 2 (ADA2 homolog, yeast)-beta; transcriptional adaptor 2B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcccacgttggtgcttcccggactccccaagaggtgatggagcattacgtgagcatgtacatccacgggaacctggggaaggcctgcatccccgacaccatccccaaccgcgtgacagaccacacctgtcccagcggaggccccctctcacccagcctcaccaccccgctgcccccgctggacatctctgtggctgagcagcagcagctgggctacatgccgctgcgggatgattacgagatcgagtatgaccaggatgccgagacgctcatcagcgggctctctgtcaactatgatgacgacgacgtggagatcgagctgaagcgcgcccacgtggacatgtacgtgcggaagctgaaagagagacagcggcggaagaacatcgcccgtgactacaatctggtgccagccttcctggggaaggacaagaaggagaaggaaaaggcgctgaagcgcaagatcaccaaggaggagaaggagctgcgcctgaagctgaggccgctgtaccagttcatgtcatgcaaggagtttgatgacctttttgaaaacatgcacaaagaaaaaatgctccgggccaagatccgagaactgcagcggtaccggcgaaacgggatcaccaagatggaagagtcggcagagtacgaggcagcgcggcataaacgggagaagaggaaggagaacaaaaacctagccggctccaaacggggaaaggaggacggcaaagacagcgagttcgccgccattgagaaccttccaggcttcgagctcctgtcagatcgcgagaaggtgctctgcagctctttaaacttgagtccagcccgctacgtgactgtgaagactattataattaaagaccacctccagaagcggcaaggaatcccctccaaaagccgccttcctagctacctggacaaagtcctaaagaaaaggattttgaatttcctcacagaaagcggctggatctccagggacgcgtcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chaperonin containing TCP1, subunit 8 (theta)-like 2 - transforming, acidic coiled-coil containing protein 3 - leucine rich repeat (in FLII) interacting protein 1 - UPF2 regulator of nonsense transcripts homolog (yeast) |