Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OR5F1-olfactory receptor, family 5, subfamily F, member 1 Gene
PTXBC101239
New product
Data sheet of OR5F1-olfactory receptor, family 5, subfamily F, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OR5F1-olfactory receptor, family 5, subfamily F, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC101239 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OR5F1 |
| Origin species: | Human |
| Product name: | OR5F1-olfactory receptor, family 5, subfamily F, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC101239 |
| Gene id: | 338674 |
| Gene description: | olfactory receptor, family 5, subfamily F, member 1 |
| Synonyms: | OR11-10; olfactory receptor 5F1; olfactory receptor 11-10; olfactory receptor OR11-167; olfactory receptor family 5 subfamily F member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccagaaaaaattatacctcactgactgagttcgtcctattgggattagcagacacgctggagctacagattatcctctttttgttttttcttgtgatttatacacttacagtactgggaaatctcgggatgatcctcttaatcaggatcgattcccagcttcacacacccatgtatttcttcctggctaacctgtcctttgtggacgtttgtaactcaactaccatcaccccaaagatgctggcagatttattatcagagaagaaaaccatctcttttgctggctgcttcctacagatgtacttctttatctccctggcgacaaccgaatgcatcctctttgggttaatggcctatgaccggtatgcggccatatgtcgcccgctgctttactccttgatcatgtccaggaccgtctacctaaaaatggcagccggggcttttgctgcagggttgctgaacttcatggtcaacacaagccatgtcagcagcttgtcattctgtgactccaatgtcatccatcacttcttctgtgacagtcccccacttttcaagctctcttgttctgacacaatcctgaaagaaagcataagttctattttggctggtgtgaatattgtggggactctgcttgtcatcctctcctcctactcctacgttctcttctccattttttctatgcattcgggggaggggaggcacagagctttctccacgtgtgcctctcacctgacagccataattctgttctatgccacctgcatctatacttacctgagacctagttccagctactccctgaatcaggacaaagtggcttctgtgttctacacagtggtgattcccatgttgaatcctctgatctacagcctcaggaataaggaagtaaagaaggctttagcgaatgtaattagcaggaaaaggacctcttcctttctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - uncoupling protein 1 (mitochondrial, proton carrier) - olfactory receptor, family 2, subfamily B, member 6 - olfactory receptor, family 2, subfamily J, member 2 - colony stimulating factor 2 (granulocyte-macrophage) |