Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UCP1-uncoupling protein 1 (mitochondrial, proton carrier) Gene
PTXBC098168
New product
Data sheet of UCP1-uncoupling protein 1 (mitochondrial, proton carrier) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCP1-uncoupling protein 1 (mitochondrial, proton carrier) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC098168 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCP1 |
| Origin species: | Human |
| Product name: | UCP1-uncoupling protein 1 (mitochondrial, proton carrier) Gene |
| Size: | 2ug |
| Accessions: | BC098168 |
| Gene id: | 7350 |
| Gene description: | uncoupling protein 1 (mitochondrial, proton carrier) |
| Synonyms: | SLC25A7; UCP; mitochondrial brown fat uncoupling protein 1; solute carrier family 25 member 7; thermogenin; uncoupling protein 1 (mitochondrial, proton carrier); uncoupling protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggggcctgacagcctcggacgtacacccgaccctgggggtccagctcttctcagctggaatagcggcgtgcttggcggacgtgatcaccttcccgctggacacggccaaagtccggctccaggtccaaggtgaatgcccgacgtccagtgttattaggtataaaggtgtcctgggaacaatcaccgctgtggtaaaaacagaagggcggatgaaactctacagcgggctgcctgcggggcttcagcggcaaatcagctccgcctctctcaggatcggcctctacgacacggtccaggagttcctcaccgcagggaaagaaacagcacctagtttaggaagcaagattttagctggtctaacgactggaggagtggcagtattcattgggcaacccacagaggtcgtgaaagtcagacttcaagcacagagccatctccacggaatcaaacctcgctacacggggacttataatgcgtacagaataatagcaacaaccgaaggcttgacgggtctttggaaagggactactcccaatctgatgagaagtgtcatcatcaattgtacagagctagtaacatatgatctaatgaaggaggcctttgtgaaaaacaacatattagcagatgacgtcccctgccacttggtgtcggctcttatcgctggattttgcgcaacagctatgtcctccccggtggatgtagtaaaaaccagatttattaattctccaccaggacagtacaaaagtgtgcccaactgtgcaatgaaagtgttcactaacgaaggaccaacggctttcttcaaggggttggtaccttccttcttgcgacttggatcctggaacgtcattatgtttgtgtgctttgaacaactgaaacgagaactgtcaaagtcaaggcagactatggactgtgccacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - olfactory receptor, family 2, subfamily B, member 6 - olfactory receptor, family 2, subfamily J, member 2 - colony stimulating factor 2 (granulocyte-macrophage) - olfactory receptor, family 2, subfamily A, member 4 |