Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TREML1-triggering receptor expressed on myeloid cells-like 1 Gene
PTXBC100945
New product
Data sheet of TREML1-triggering receptor expressed on myeloid cells-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TREML1-triggering receptor expressed on myeloid cells-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC100945 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TREML1 |
| Origin species: | Human |
| Product name: | TREML1-triggering receptor expressed on myeloid cells-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC100945 |
| Gene id: | 340205 |
| Gene description: | triggering receptor expressed on myeloid cells-like 1 |
| Synonyms: | GLTL1825; PRO3438; TLT-1; TLT1; dJ238O23.3; trem-like transcript 1 protein; triggering receptor expressed on myeloid cells-like protein 1; triggering receptor expressed on myeloid cells like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcctcaccctgctcttgctgctgctcctgggactagaaggtcagggcatagttggcagcctccctgaggtgctgcaggcacccgtgggaagctccattctggtgcagtgccactacaggctccaggatgtcaaagctcagaaggtgtggtgccggttcttgccggaggggtgccagcccctggtgtcctcagctgtggatcgcagagctccagcgggcaggcgtacgtttctcacagacctgggtgggggcctgctgcaggtggaaatggttaccctgcaggaagaggatgctggcgagtatggctgcatggtggatggggccagggggccccagattttgcacagagtctctctgaacatactgcccccagaggaagaagaagagacccataagattggcagtctggctgagaacgcattctcagaccctgcaggcagtgccaaccctttggaacccagccaggatgagaagagcatccccttgatctggggtgctgtgctcctggtaggtctgctggtggcagcggtggtgctgtttgctgtgatggccaagaggaaacaagggaacaggcttggtgtctgtggccgattcctgagcagcagagtttcaggcatgaatccctcctcagtggtccaccacgtcagtgactctggaccggctgctgaattgcctttggatgtaccacacattaggcttgactcaccaccttcatttgacaataccacctacaccagcctacctcttgattccccatcaggaaaaccttcactcccagctccatcctcattgccccctctacctcctaaggtcctggtctgctccaagcctgtgacatatgccacagtaatcttcccgggagggaacaagggtggagggacctcgtgtgggccagcccagaatccacctaacaatcagactccatccagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily F, polypeptide 1 - germ and embryonic stem cell enriched protein STELLA - proteasome (prosome, macropain) subunit, alpha type, 5 - killer cell lectin-like receptor subfamily B, member 1 |